1AIF | | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB FROM MOUSE | | Descriptor: | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (LIGHT CHAIN), ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (HEAVY CHAIN) | | Authors: | Ban, N., Escobar, C., Hasel, K., Day, J., Greenwood, A., McPherson, A. | | Deposit date: | 1994-11-14 | | Release date: | 1997-02-01 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structure of an anti-idiotypic Fab against feline peritonitis virus-neutralizing antibody and a comparison with the complexed Fab.
FASEB J., 9, 1995
|
|
1FFK | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ... | | Authors: | Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1C04 | | IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ... | | Authors: | Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A. | | Deposit date: | 1999-07-14 | | Release date: | 1999-08-31 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (5 Å) | | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
|
|
1IAI | | IDIOTYPE-ANTI-IDIOTYPE FAB COMPLEX | | Descriptor: | IDIOTYPIC FAB 730.1.4 (IGG1) OF VIRUS NEUTRALIZING ANTIBODY, ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) | | Authors: | Ban, N., Escobar, C., Garcia, R., Hasel, K., Day, J., Greenwood, A., McPherson, A. | | Deposit date: | 1993-12-28 | | Release date: | 1996-03-08 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structure of an idiotype-anti-idiotype Fab complex.
Proc.Natl.Acad.Sci.USA, 91, 1994
|
|
1STM | | SATELLITE PANICUM MOSAIC VIRUS | | Descriptor: | SATELLITE PANICUM MOSAIC VIRUS | | Authors: | Ban, N., McPherson, A. | | Deposit date: | 1995-07-12 | | Release date: | 1997-01-27 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | The structure of satellite panicum mosaic virus at 1.9 A resolution.
Nat.Struct.Biol., 2, 1995
|
|
1GHF | | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | | Descriptor: | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | | Authors: | Ban, N., Day, J., Wang, X., Ferrone, S., McPherson, A. | | Deposit date: | 1995-11-30 | | Release date: | 1996-12-23 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structure of an anti-anti-idiotype shows it to be self-complementary.
J.Mol.Biol., 255, 1996
|
|
4B0R | | STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY | | Descriptor: | DEAMIDASE-DEPUPYLASE DOP | | Authors: | Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Last modified: | 2019-02-27 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of Pup ligase PafA and depupylase Dop from the prokaryotic ubiquitin-like modification pathway.
Nat Commun, 3, 2012
|
|
4B0S | | STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ATP | | Descriptor: | DEAMIDASE-DEPUPYLASE DOP, ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION | | Authors: | Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Last modified: | 2020-04-01 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
|
|
4B0T | | STRUCTURE OF THE PUP LIGASE PAFA OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ADP | | Descriptor: | PUP--PROTEIN LIGASE, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION | | Authors: | Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Method: | X-RAY DIFFRACTION (2.159 Å) | | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
|
|
3DKT | | CRYSTAL STRUCTURE OF THERMOTOGA MARITIMA ENCAPSULIN | | Descriptor: | Maritimacin, Putative uncharacterized protein | | Authors: | Sutter, M., Boehringer, D., Gutmann, S., Weber-Ban, E., Ban, N. | | Deposit date: | 2008-06-26 | | Release date: | 2008-09-02 | | Last modified: | 2019-11-06 | | Method: | X-RAY DIFFRACTION (3.104 Å) | | Cite: | Structural basis of enzyme encapsulation into a bacterial nanocompartment
Nat.Struct.Mol.Biol., 15, 2008
|
|
4BJR | | CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN PROKARYOTIC UBIQUITIN-LIKE PROTEIN PUP AND ITS LIGASE PAFA | | Descriptor: | PUP--PROTEIN LIGASE, PROKARYOTIC UBIQUITIN-LIKE PROTEIN PUP, ADENOSINE-5'-TRIPHOSPHATE, ... | | Authors: | Barandun, J., Delley, C.L., Ban, N., Weber-Ban, E. | | Deposit date: | 2013-04-19 | | Release date: | 2013-05-01 | | Last modified: | 2013-05-22 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal Structure of the Complex between Prokaryotic Ubiquitin-Like Protein Pup and its Ligase Pafa.
J.Am.Chem.Soc., 135, 2013
|
|
5LFJ | | CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | | Deposit date: | 2016-07-01 | | Release date: | 2016-11-23 | | Last modified: | 2016-12-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LFP | | CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS (SPACE GROUP P6322, SEMET) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2016-12-14 | | Method: | X-RAY DIFFRACTION (3.303 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LFQ | | CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS (SPACE GROUP P3) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2016-12-14 | | Method: | X-RAY DIFFRACTION (3.503 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LRT | | STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ADP AND PHOSPHATE | | Descriptor: | Depupylase, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, ... | | Authors: | Bolten, M., Vahlensieck, C., Lipp, C., Leibundgut, M., Ban, N., Weber-Ban, E. | | Deposit date: | 2016-08-19 | | Release date: | 2017-02-01 | | Last modified: | 2017-03-22 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis.
J. Biol. Chem., 292, 2017
|
|
5LZP | | BINDING OF THE C-TERMINAL GQYL MOTIF OF THE BACTERIAL PROTEASOME ACTIVATOR BPA TO THE 20S PROTEASOME | | Descriptor: | Proteasome subunit alpha, Bacterial proteasome activator, Proteasome subunit beta | | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | | Deposit date: | 2016-09-30 | | Release date: | 2016-11-23 | | Last modified: | 2019-10-23 | | Method: | ELECTRON MICROSCOPY (3.45 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
6SJ9 | | PROTEASOME ACCESSORY FACTOR B/C (PAFBC) OF ARTHROBACTER AURESCENS | | Descriptor: | Proteasome accessory factor B/C (PafBC), POTASSIUM ION, THIOCYANATE ION, ... | | Authors: | Mueller, A.U., Leibundgut, M., Ban, N., Weber-Ban, E. | | Deposit date: | 2019-08-13 | | Release date: | 2019-10-16 | | Last modified: | 2019-10-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure and functional implications of WYL domain-containing bacterial DNA damage response regulator PafBC.
Nat Commun, 10, 2019
|
|
1FFZ | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1K8A | | CO-CRYSTAL STRUCTURE OF CARBOMYCIN A BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI | | Descriptor: | 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ... | | Authors: | Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T. | | Deposit date: | 2001-10-23 | | Release date: | 2002-07-19 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
1FG0 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
3MEY | | CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH ATP | | Descriptor: | Bll0957 protein, ZINC ION, MAGNESIUM ION, ... | | Authors: | Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N. | | Deposit date: | 2010-04-01 | | Release date: | 2010-07-28 | | Last modified: | 2017-11-08 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3MF1 | | CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH AN ANALOGUE OF GLYCYL ADENYLATE | | Descriptor: | Bll0957 protein, ZINC ION, 5'-O-(glycylsulfamoyl)adenosine | | Authors: | Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N. | | Deposit date: | 2010-04-01 | | Release date: | 2010-07-28 | | Last modified: | 2017-11-08 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3MF2 | | CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH AMP | | Descriptor: | Bll0957 protein, ZINC ION, ADENOSINE MONOPHOSPHATE, ... | | Authors: | Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N. | | Deposit date: | 2010-04-01 | | Release date: | 2010-07-28 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
2VZ8 | |
2VZ9 | |
