Author results

1AIF
  • Download 1aif
  • View 1aif
Molmil generated image of 1aif
ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB FROM MOUSE
Descriptor:ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (LIGHT CHAIN), ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (HEAVY CHAIN)
Authors:Ban, N., Escobar, C., Hasel, K., Day, J., Greenwood, A., McPherson, A.
Deposit date:1994-11-14
Release date:1997-02-01
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Structure of an anti-idiotypic Fab against feline peritonitis virus-neutralizing antibody and a comparison with the complexed Fab.
FASEB J., 9, 1995
1FFK
  • Download 1ffk
  • View 1ffk
Molmil generated image of 1ffk
CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-25
Release date:2000-08-14
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
1C04
  • Download 1c04
  • View 1c04
Molmil generated image of 1c04
IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI
Descriptor:23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ...
Authors:Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A.
Deposit date:1999-07-14
Release date:1999-08-31
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (5 Å)
Cite:Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
1IAI
  • Download 1iai
  • View 1iai
Molmil generated image of 1iai
IDIOTYPE-ANTI-IDIOTYPE FAB COMPLEX
Descriptor:IDIOTYPIC FAB 730.1.4 (IGG1) OF VIRUS NEUTRALIZING ANTIBODY, ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A)
Authors:Ban, N., Escobar, C., Garcia, R., Hasel, K., Day, J., Greenwood, A., McPherson, A.
Deposit date:1993-12-28
Release date:1996-03-08
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structure of an idiotype-anti-idiotype Fab complex.
Proc.Natl.Acad.Sci.USA, 91, 1994
1STM
  • Download 1stm
  • View 1stm
Molmil generated image of 1stm
SATELLITE PANICUM MOSAIC VIRUS
Descriptor:SATELLITE PANICUM MOSAIC VIRUS
Authors:Ban, N., McPherson, A.
Deposit date:1995-07-12
Release date:1997-01-27
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.9 Å)
Cite:The structure of satellite panicum mosaic virus at 1.9 A resolution.
Nat.Struct.Biol., 2, 1995
1GHF
  • Download 1ghf
  • View 1ghf
Molmil generated image of 1ghf
ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT
Descriptor:ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT
Authors:Ban, N., Day, J., Wang, X., Ferrone, S., McPherson, A.
Deposit date:1995-11-30
Release date:1996-12-23
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structure of an anti-anti-idiotype shows it to be self-complementary.
J.Mol.Biol., 255, 1996
4B0R
  • Download 4b0r
  • View 4b0r
Molmil generated image of 4b0r
STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY
Descriptor:DEAMIDASE-DEPUPYLASE DOP
Authors:Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E.
Deposit date:2012-07-04
Release date:2012-09-12
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
4B0S
  • Download 4b0s
  • View 4b0s
Molmil generated image of 4b0s
STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ATP
Descriptor:DEAMIDASE-DEPUPYLASE DOP, ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION
Authors:Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E.
Deposit date:2012-07-04
Release date:2012-09-12
Last modified:2013-02-06
Method:X-RAY DIFFRACTION (2.85 Å)
Cite:Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
4B0T
  • Download 4b0t
  • View 4b0t
Molmil generated image of 4b0t
STRUCTURE OF THE PUP LIGASE PAFA OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ADP
Descriptor:PUP--PROTEIN LIGASE, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION
Authors:Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E.
Deposit date:2012-07-04
Release date:2012-09-12
Method:X-RAY DIFFRACTION (2.159 Å)
Cite:Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
3DKT
  • Download 3dkt
  • View 3dkt
Molmil generated image of 3dkt
CRYSTAL STRUCTURE OF THERMOTOGA MARITIMA ENCAPSULIN
Descriptor:Maritimacin, Putative uncharacterized protein
Authors:Sutter, M., Boehringer, D., Gutmann, S., Weber-Ban, E., Ban, N.
Deposit date:2008-06-26
Release date:2008-09-02
Last modified:2011-08-31
Method:X-RAY DIFFRACTION (3.104 Å)
Cite:Structural basis of enzyme encapsulation into a bacterial nanocompartment
Nat.Struct.Mol.Biol., 15, 2008
4BJR
  • Download 4bjr
  • View 4bjr
Molmil generated image of 4bjr
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN PROKARYOTIC UBIQUITIN-LIKE PROTEIN PUP AND ITS LIGASE PAFA
Descriptor:PUP--PROTEIN LIGASE, PROKARYOTIC UBIQUITIN-LIKE PROTEIN PUP, ADENOSINE-5'-TRIPHOSPHATE, ...
Authors:Barandun, J., Delley, C.L., Ban, N., Weber-Ban, E.
Deposit date:2013-04-19
Release date:2013-05-01
Last modified:2013-05-22
Method:X-RAY DIFFRACTION (2.8 Å)
Cite:Crystal Structure of the Complex between Prokaryotic Ubiquitin-Like Protein Pup and its Ligase Pafa.
J.Am.Chem.Soc., 135, 2013
5LFJ
  • Download 5lfj
  • View 5lfj
Molmil generated image of 5lfj
CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS
Descriptor:Bacterial proteasome activator
Authors:Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E.
Deposit date:2016-07-01
Release date:2016-11-23
Last modified:2016-12-14
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
5LFP
  • Download 5lfp
  • View 5lfp
Molmil generated image of 5lfp
CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS (SPACE GROUP P6322, SEMET)
Descriptor:Bacterial proteasome activator
Authors:Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E.
Deposit date:2016-07-04
Release date:2016-11-23
Last modified:2016-12-14
Method:X-RAY DIFFRACTION (3.303 Å)
Cite:Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
5LFQ
  • Download 5lfq
  • View 5lfq
Molmil generated image of 5lfq
CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS (SPACE GROUP P3)
Descriptor:Bacterial proteasome activator
Authors:Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E.
Deposit date:2016-07-04
Release date:2016-11-23
Last modified:2016-12-14
Method:X-RAY DIFFRACTION (3.503 Å)
Cite:Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
5LRT
  • Download 5lrt
  • View 5lrt
Molmil generated image of 5lrt
STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ADP AND PHOSPHATE
Descriptor:Depupylase, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, ...
Authors:Bolten, M., Vahlensieck, C., Lipp, C., Leibundgut, M., Ban, N., Weber-Ban, E.
Deposit date:2016-08-19
Release date:2017-02-01
Last modified:2017-03-22
Method:X-RAY DIFFRACTION (1.85 Å)
Cite:Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis.
J. Biol. Chem., 292, 2017
5LZP
  • Download 5lzp
  • View 5lzp
Molmil generated image of 5lzp
BINDING OF THE C-TERMINAL GQYL MOTIF OF THE BACTERIAL PROTEASOME ACTIVATOR BPA TO THE 20S PROTEASOME
Descriptor:Proteasome subunit alpha, Bacterial proteasome activator, Proteasome subunit beta
Authors:Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E.
Deposit date:2016-09-30
Release date:2016-11-23
Last modified:2018-10-17
Method:ELECTRON MICROSCOPY (3.45 Å)
Cite:Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
1FFZ
  • Download 1ffz
  • View 1ffz
Molmil generated image of 1ffz
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN
Descriptor:23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU))
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
1K8A
  • Download 1k8a
  • View 1k8a
Molmil generated image of 1k8a
CO-CRYSTAL STRUCTURE OF CARBOMYCIN A BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
Descriptor:23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ...
Authors:Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T.
Deposit date:2001-10-23
Release date:2002-07-19
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
1FG0
  • Download 1fg0
  • View 1fg0
Molmil generated image of 1fg0
LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND
Descriptor:23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'
Authors:Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.
Deposit date:2000-07-26
Release date:2000-08-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
3MEY
  • Download 3mey
  • View 3mey
Molmil generated image of 3mey
CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH ATP
Descriptor:Bll0957 protein, ZINC ION, MAGNESIUM ION, ...
Authors:Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N.
Deposit date:2010-04-01
Release date:2010-07-28
Last modified:2017-11-08
Method:X-RAY DIFFRACTION (2.5 Å)
Cite:Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
3MF1
  • Download 3mf1
  • View 3mf1
Molmil generated image of 3mf1
CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH AN ANALOGUE OF GLYCYL ADENYLATE
Descriptor:Bll0957 protein, ZINC ION, 5'-O-(glycylsulfamoyl)adenosine
Authors:Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N.
Deposit date:2010-04-01
Release date:2010-07-28
Last modified:2017-11-08
Method:X-RAY DIFFRACTION (2.2 Å)
Cite:Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
3MF2
  • Download 3mf2
  • View 3mf2
Molmil generated image of 3mf2
CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH AMP
Descriptor:Bll0957 protein, ZINC ION, ADENOSINE MONOPHOSPHATE, ...
Authors:Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N.
Deposit date:2010-04-01
Release date:2010-07-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.15 Å)
Cite:Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis
Proc.Natl.Acad.Sci.USA, 107, 2010
2VZ8
  • Download 2vz8
  • View 2vz8
Molmil generated image of 2vz8
CRYSTAL STRUCTURE OF MAMMALIAN FATTY ACID SYNTHASE
Descriptor:FATTY ACID SYNTHASE
Authors:Maier, T., Leibundgut, M., Ban, N.
Deposit date:2008-07-31
Release date:2008-09-09
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.219 Å)
Cite:The Crystal Structure of a Mammalian Fatty Acid Synthase.
Science, 321, 2008
2VZ9
  • Download 2vz9
  • View 2vz9
Molmil generated image of 2vz9
CRYSTAL STRUCTURE OF MAMMALIAN FATTY ACID SYNTHASE IN COMPLEX WITH NADP
Descriptor:FATTY ACID SYNTHASE, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE
Authors:Maier, T., Leibundgut, M., Ban, N.
Deposit date:2008-07-31
Release date:2008-09-09
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.3 Å)
Cite:The Crystal Structure of a Mammalian Fatty Acid Synthase.
Science, 321, 2008
2XXA
  • Download 2xxa
  • View 2xxa
Molmil generated image of 2xxa
THE CRYSTAL STRUCTURE OF THE SIGNAL RECOGNITION PARTICLE (SRP) IN COMPLEX WITH ITS RECEPTOR(SR)
Descriptor:SIGNAL RECOGNITION PARTICLE PROTEIN, SRP RECEPTOR FTSY, 4.5S RNA, ...
Authors:Ataide, S.F., Schmitz, N., Shen, K., Ke, A., Shan, S., Doudna, J.A., Ban, N.
Deposit date:2010-11-09
Release date:2011-03-02
Last modified:2015-06-03
Method:X-RAY DIFFRACTION (3.94 Å)
Cite:The Crystal Structure of the Signal Recognition Particle in Complex with its Receptor.
Science, 331, 2011
PDBj@FacebookPDBj@TwitterwwPDBwwPDB Foundation

Copyright © 2013-2019 Protein Data Bank Japan