1AIF | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB FROM MOUSE | Descriptor: | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (LIGHT CHAIN), ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (HEAVY CHAIN) | Authors: | Ban, N., Escobar, C., Hasel, K., Day, J., Greenwood, A., McPherson, A. | Deposit date: | 1994-11-14 | Release date: | 1997-02-01 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structure of an anti-idiotypic Fab against feline peritonitis virus-neutralizing antibody and a comparison with the complexed Fab. FASEB J., 9, 1995
|
|
1FFK | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ... | Authors: | Ban, N., Nissen, P., Hansen, J., Moore, P.B., Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
1C04 | IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L2, RIBOSOMAL PROTEIN L6, ... | Authors: | Ban, N., Nissen, P., Capel, M., Moore, P.B., Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
1IAI | IDIOTYPE-ANTI-IDIOTYPE FAB COMPLEX | Descriptor: | IDIOTYPIC FAB 730.1.4 (IGG1) OF VIRUS NEUTRALIZING ANTIBODY, ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) | Authors: | Ban, N., Escobar, C., Garcia, R., Hasel, K., Day, J., Greenwood, A., McPherson, A. | Deposit date: | 1993-12-28 | Release date: | 1996-03-08 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of an idiotype-anti-idiotype Fab complex. Proc.Natl.Acad.Sci.USA, 91, 1994
|
|
1STM | SATELLITE PANICUM MOSAIC VIRUS | Descriptor: | SATELLITE PANICUM MOSAIC VIRUS | Authors: | Ban, N., McPherson, A. | Deposit date: | 1995-07-12 | Release date: | 1997-01-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | The structure of satellite panicum mosaic virus at 1.9 A resolution. Nat.Struct.Biol., 2, 1995
|
|
1GHF | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | Descriptor: | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | Authors: | Ban, N., Day, J., Wang, X., Ferrone, S., McPherson, A. | Deposit date: | 1995-11-30 | Release date: | 1996-12-23 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of an anti-anti-idiotype shows it to be self-complementary. J.Mol.Biol., 255, 1996
|
|
4B0R | STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY | Descriptor: | DEAMIDASE-DEPUPYLASE DOP | Authors: | Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
4B0S | STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ATP | Descriptor: | DEAMIDASE-DEPUPYLASE DOP, ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION | Authors: | Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Last modified: | 2013-02-06 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
4B0T | STRUCTURE OF THE PUP LIGASE PAFA OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ADP | Descriptor: | PUP--PROTEIN LIGASE, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION | Authors: | Ozcelik, D., Barandun, J., Schmitz, N., Sutter, M., Guth, E., Damberger, F.F., Allain, F.H.-T., Ban, N., Weber-Ban, E. | Deposit date: | 2012-07-04 | Release date: | 2012-09-12 | Method: | X-RAY DIFFRACTION (2.159 Å) | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway. Nat.Commun., 3, 2012
|
|
3DKT | CRYSTAL STRUCTURE OF THERMOTOGA MARITIMA ENCAPSULIN | Descriptor: | Maritimacin, Putative uncharacterized protein | Authors: | Sutter, M., Boehringer, D., Gutmann, S., Weber-Ban, E., Ban, N. | Deposit date: | 2008-06-26 | Release date: | 2008-09-02 | Last modified: | 2011-08-31 | Method: | X-RAY DIFFRACTION (3.104 Å) | Cite: | Structural basis of enzyme encapsulation into a bacterial nanocompartment Nat.Struct.Mol.Biol., 15, 2008
|
|
4BJR | CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN PROKARYOTIC UBIQUITIN-LIKE PROTEIN PUP AND ITS LIGASE PAFA | Descriptor: | PUP--PROTEIN LIGASE, PROKARYOTIC UBIQUITIN-LIKE PROTEIN PUP, ADENOSINE-5'-TRIPHOSPHATE, ... | Authors: | Barandun, J., Delley, C.L., Ban, N., Weber-Ban, E. | Deposit date: | 2013-04-19 | Release date: | 2013-05-01 | Last modified: | 2013-05-22 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal Structure of the Complex between Prokaryotic Ubiquitin-Like Protein Pup and its Ligase Pafa. J.Am.Chem.Soc., 135, 2013
|
|
5LFJ | CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | Deposit date: | 2016-07-01 | Release date: | 2016-11-23 | Last modified: | 2016-12-14 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
5LFP | CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS (SPACE GROUP P6322, SEMET) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2016-12-14 | Method: | X-RAY DIFFRACTION (3.303 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
5LFQ | CRYSTAL STRUCTURE OF THE BACTERIAL PROTEASOME ACTIVATOR BPA OF MYCOBACTERIUM TUBERCULOSIS (SPACE GROUP P3) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2016-12-14 | Method: | X-RAY DIFFRACTION (3.503 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
5LRT | STRUCTURE OF THE DEAMIDASE-DEPUPYLASE DOP OF THE PROKARYOTIC UBIQUITIN-LIKE MODIFICATION PATHWAY IN COMPLEX WITH ADP AND PHOSPHATE | Descriptor: | Depupylase, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, ... | Authors: | Bolten, M., Vahlensieck, C., Lipp, C., Leibundgut, M., Ban, N., Weber-Ban, E. | Deposit date: | 2016-08-19 | Release date: | 2017-02-01 | Last modified: | 2017-03-22 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis. J. Biol. Chem., 292, 2017
|
|
5LZP | BINDING OF THE C-TERMINAL GQYL MOTIF OF THE BACTERIAL PROTEASOME ACTIVATOR BPA TO THE 20S PROTEASOME | Descriptor: | Proteasome subunit alpha, Bacterial proteasome activator, Proteasome subunit beta | Authors: | Bolten, M., Delley, C.L., Leibundgut, M., Boehringer, D., Ban, N., Weber-Ban, E. | Deposit date: | 2016-09-30 | Release date: | 2016-11-23 | Last modified: | 2018-10-17 | Method: | ELECTRON MICROSCOPY (3.45 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
1FFZ | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1K8A | CO-CRYSTAL STRUCTURE OF CARBOMYCIN A BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA, 5S RRNA, RIBOSOMAL PROTEIN L2, ... | Authors: | Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1FG0 | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
3MEY | CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH ATP | Descriptor: | Bll0957 protein, ZINC ION, MAGNESIUM ION, ... | Authors: | Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N. | Deposit date: | 2010-04-01 | Release date: | 2010-07-28 | Last modified: | 2017-11-08 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3MF1 | CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH AN ANALOGUE OF GLYCYL ADENYLATE | Descriptor: | Bll0957 protein, ZINC ION, 5'-O-(glycylsulfamoyl)adenosine | Authors: | Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N. | Deposit date: | 2010-04-01 | Release date: | 2010-07-28 | Last modified: | 2017-11-08 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3MF2 | CRYSTAL STRUCTURE OF CLASS II AARS HOMOLOGUE (BLL0957) COMPLEXED WITH AMP | Descriptor: | Bll0957 protein, ZINC ION, ADENOSINE MONOPHOSPHATE, ... | Authors: | Weygand-Durasevic, I., Mocibob, M., Ivic, N., Bilokapic, S., Maier, T., Luic, M., Ban, N. | Deposit date: | 2010-04-01 | Release date: | 2010-07-28 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.15 Å) | Cite: | Homologs of aminoacyl-tRNA synthetases acylate carrier proteins and provide a link between ribosomal and nonribosomal peptide synthesis Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
2VZ8 | |
2VZ9 | |
2XXA | THE CRYSTAL STRUCTURE OF THE SIGNAL RECOGNITION PARTICLE (SRP) IN COMPLEX WITH ITS RECEPTOR(SR) | Descriptor: | SIGNAL RECOGNITION PARTICLE PROTEIN, SRP RECEPTOR FTSY, 4.5S RNA, ... | Authors: | Ataide, S.F., Schmitz, N., Shen, K., Ke, A., Shan, S., Doudna, J.A., Ban, N. | Deposit date: | 2010-11-09 | Release date: | 2011-03-02 | Last modified: | 2015-06-03 | Method: | X-RAY DIFFRACTION (3.94 Å) | Cite: | The Crystal Structure of the Signal Recognition Particle in Complex with its Receptor. Science, 331, 2011
|
|