1C04
| IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | Deposit date: | 1999-07-14 | Release date: | 1999-08-31 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (5 Å) | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit. Nature, 400, 1999
|
|
1AIF
| ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB FROM MOUSE | Descriptor: | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (HEAVY CHAIN), ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A) FAB (LIGHT CHAIN) | Authors: | Ban, N, Escobar, C, Hasel, K, Day, J, Greenwood, A, McPherson, A. | Deposit date: | 1994-11-14 | Release date: | 1997-02-01 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structure of an anti-idiotypic Fab against feline peritonitis virus-neutralizing antibody and a comparison with the complexed Fab. FASEB J., 9, 1995
|
|
1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
1IAI
| IDIOTYPE-ANTI-IDIOTYPE FAB COMPLEX | Descriptor: | ANTI-IDIOTYPIC FAB 409.5.3 (IGG2A), IDIOTYPIC FAB 730.1.4 (IGG1) OF VIRUS NEUTRALIZING ANTIBODY | Authors: | Ban, N, Escobar, C, Garcia, R, Hasel, K, Day, J, Greenwood, A, McPherson, A. | Deposit date: | 1993-12-28 | Release date: | 1996-03-08 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of an idiotype-anti-idiotype Fab complex. Proc.Natl.Acad.Sci.USA, 91, 1994
|
|
1GHF
| ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | Descriptor: | ANTI-ANTI-IDIOTYPE GH1002 FAB FRAGMENT | Authors: | Ban, N, Day, J, Wang, X, Ferrone, S, McPherson, A. | Deposit date: | 1995-11-30 | Release date: | 1996-12-23 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structure of an anti-anti-idiotype shows it to be self-complementary. J.Mol.Biol., 255, 1996
|
|
1STM
| SATELLITE PANICUM MOSAIC VIRUS | Descriptor: | SATELLITE PANICUM MOSAIC VIRUS | Authors: | Ban, N, McPherson, A. | Deposit date: | 1995-07-12 | Release date: | 1997-01-27 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | The structure of satellite panicum mosaic virus at 1.9 A resolution. Nat.Struct.Biol., 2, 1995
|
|
4V19
| Structure of the large subunit of the mammalian mitoribosome, part 1 of 2 | Descriptor: | MAGNESIUM ION, MITORIBOSOMAL 16S RRNA, MITORIBOSOMAL CP TRNA, ... | Authors: | Greber, B.J, Boehringer, D, Leibundgut, M, Bieri, P, Leitner, A, Schmitz, N, Aebersold, R, Ban, N. | Deposit date: | 2014-09-25 | Release date: | 2014-10-08 | Last modified: | 2019-10-23 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | The Complete Structure of the Large Subunit of the Mammalian Mitochondrial Ribosome Nature, 515, 2014
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
5A2Q
| Structure of the HCV IRES bound to the human ribosome | Descriptor: | 18S RRNA, HCV IRES, MAGNESIUM ION, ... | Authors: | Quade, N, Leiundgut, M, Boehringer, D, Heuvel, J.v.d, Ban, N. | Deposit date: | 2015-05-21 | Release date: | 2015-07-15 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Cryo-Em Structure of Hepatitis C Virus Ires Bound to the Human Ribosome at 3.9 Angstrom Resolution Nat.Commun., 6, 2015
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
8PPL
| MERS-CoV Nsp1 bound to the human 43S pre-initiation complex | Descriptor: | 18S rRNA, 40S ribosomal protein S10, 40S ribosomal protein S11, ... | Authors: | Schubert, K, Karousis, E.D, Ban, I, Lapointe, C.P, Leibundgut, M, Baeumlin, E, Kummerant, E, Scaiola, A, Schoenhut, T, Ziegelmueller, J, Puglisi, J.D, Muehlemann, O, Ban, N. | Deposit date: | 2023-07-07 | Release date: | 2023-10-18 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.65 Å) | Cite: | Universal features of Nsp1-mediated translational shutdown by coronaviruses. Mol.Cell, 83, 2023
|
|
8PPK
| Bat-Hp-CoV Nsp1 and eIF1 bound to the human 40S small ribosomal subunit | Descriptor: | 18S rRNA, 40S ribosomal protein S10, 40S ribosomal protein S11, ... | Authors: | Schubert, K, Karousis, E.D, Ban, I, Lapointe, C.P, Leibundgut, M, Baeumlin, E, Kummerant, E, Scaiola, A, Schoenhut, T, Ziegelmueller, J, Puglisi, J.D, Muehlemann, O, Ban, N. | Deposit date: | 2023-07-07 | Release date: | 2023-10-18 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.98 Å) | Cite: | Universal features of Nsp1-mediated translational shutdown by coronaviruses. Mol.Cell, 83, 2023
|
|
6SJ9
| Proteasome accessory factor B/C (PafBC) of Arthrobacter aurescens | Descriptor: | DI(HYDROXYETHYL)ETHER, POTASSIUM ION, Proteasome accessory factor B/C (PafBC), ... | Authors: | Mueller, A.U, Leibundgut, M, Ban, N, Weber-Ban, E. | Deposit date: | 2019-08-13 | Release date: | 2019-10-16 | Last modified: | 2019-10-23 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structure and functional implications of WYL domain-containing bacterial DNA damage response regulator PafBC. Nat Commun, 10, 2019
|
|
1K8A
| Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
5APO
| Structure of the yeast 60S ribosomal subunit in complex with Arx1, Alb1 and C-terminally tagged Rei1 | Descriptor: | 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Greber, B.J, Gerhardy, S, Leitner, A, Leibundgut, M, Salem, M, Boehringer, D, Leulliot, N, Aebersold, R, Panse, V.G, Ban, N. | Deposit date: | 2015-09-17 | Release date: | 2015-12-16 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.41 Å) | Cite: | Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. Cell(Cambridge,Mass.), 164, 2016
|
|
5AJ3
| Structure of the small subunit of the mammalian mitoribosome | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, MITORIBOSOMAL 12S RRNA, ... | Authors: | Greber, B.J, Bieri, P, Leibundgut, M, Leitner, A, Aebersold, R, Boehringer, D, Ban, N. | Deposit date: | 2015-02-20 | Release date: | 2015-04-22 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome. Science, 348, 2015
|
|
5AJ4
| Structure of the 55S mammalian mitoribosome. | Descriptor: | 28S RIBOSOMAL PROTEIN S18B, MITOCHONDRIAL, GUANOSINE-5'-DIPHOSPHATE, ... | Authors: | Greber, B.J, Bieri, P, Leibundgut, M, Leitner, A, Aebersold, R, Boehringer, D, Ban, N. | Deposit date: | 2015-02-20 | Release date: | 2015-04-22 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | The complete structure of the 55S mammalian mitochondrial ribosome. Science, 348, 2015
|
|
4V8P
| T.thermophila 60S ribosomal subunit in complex with initiation factor 6. | Descriptor: | 26S RRNA, 5.8S RRNA, 5S RRNA, ... | Authors: | Klinge, S, Voigts-Hoffmann, F, Leibundgut, M, Arpagaus, S, Ban, N. | Deposit date: | 2011-09-14 | Release date: | 2014-07-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.52 Å) | Cite: | Crystal Structure of the Eukaryotic 60S Ribosomal Subunit in Complex with Initiation Factor 6. Science, 334, 2011
|
|
4V58
| Crystal structure of fatty acid synthase from thermomyces lanuginosus at 3.1 angstrom resolution. | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | Deposit date: | 2007-03-09 | Release date: | 2014-07-09 | Last modified: | 2019-06-12 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling Science, 316, 2007
|
|
4V8L
| |
4V8T
| Cryo-EM Structure of the 60S Ribosomal Subunit in Complex with Arx1 and Rei1 | Descriptor: | 25S RIBOSOMAL RNA, 5.8S RIBOSOMAL RNA, 5S RIBOSOMAL RNA, ... | Authors: | Greber, B.J, Boehringer, D, Montellese, C, Ban, N. | Deposit date: | 2012-08-07 | Release date: | 2014-07-09 | Last modified: | 2019-10-23 | Method: | ELECTRON MICROSCOPY (8.1 Å) | Cite: | Cryo-Em Structures of Arx1 and Maturation Factors Rei1 and Jjj1 Bound to the 60S Ribosomal Subunit Nat.Struct.Mol.Biol., 19, 2012
|
|
4V5B
| Structure of PDF binding helix in complex with the ribosome. | Descriptor: | 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, ... | Authors: | Bingel-Erlenmeyer, R, Kohler, R, Kramer, G, Sandikci, A, Antolic, S, Maier, T, Schaffitzel, C, Wiedmann, B, Bukau, B, Ban, N. | Deposit date: | 2007-11-22 | Release date: | 2014-07-09 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.74 Å) | Cite: | A Peptide Deformylase-Ribosome Complex Reveals Mechanism of Nascent Chain Processing. Nature, 452, 2008
|
|
5LFQ
| Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P3) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.503 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
5LFJ
| Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-01 | Release date: | 2016-11-23 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|
5LFP
| Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P6322, SeMet) | Descriptor: | Bacterial proteasome activator | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | Deposit date: | 2016-07-04 | Release date: | 2016-11-23 | Last modified: | 2016-12-14 | Method: | X-RAY DIFFRACTION (3.303 Å) | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome. Structure, 24, 2016
|
|