2EUY
| Solution structure of the internal loop of human U65 H/ACA snoRNA 3' hairpin | Descriptor: | U65 box H/ACA snoRNA | Authors: | Feigon, J, Khanna, M, Wu, H, Johansson, C, Caizergues-Ferrer, M. | Deposit date: | 2005-10-30 | Release date: | 2006-01-03 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Structural study of the H/ACA snoRNP components Nop10p and the 3' hairpin of U65 snoRNA. Rna, 12, 2006
|
|
2QH3
| |
2QH4
| |
2QH2
| |
230D
| |
1QWA
| NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
2K96
| Solution structure of the RDC-refined P2B-P3 pseudoknot from human telomerase RNA (delta U177) | Descriptor: | TELOMERASE RNA P2B-P3 PSEUDOKNOT | Authors: | Kim, N.-K, Zhang, Q, Zhou, J, Theimer, C.A, Peterson, R.D, Feigon, J. | Deposit date: | 2008-09-29 | Release date: | 2008-11-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure and Dynamics of the Wild-type Pseudoknot of Human Telomerase RNA. J.Mol.Biol., 384, 2008
|
|
6TZN
| Structure of S. pombe telomerase accessory protein Pof8 C-terminal domain | Descriptor: | NITRATE ION, Protein pof8 | Authors: | Basu, R.S, Cascio, D, Eichhorn, C.D, Feigon, J. | Deposit date: | 2019-08-12 | Release date: | 2020-08-19 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.35 Å) | Cite: | Structure of S. pombe telomerase protein Pof8 C-terminal domain is an xRRM conserved among LARP7 proteins. Rna Biol., 18, 2021
|
|
8GAP
| Structure of LARP7 protein p65-telomerase RNA complex in telomerase | Descriptor: | Telomerase La-related protein p65, Telomerase RNA, Telomerase associated protein p50, ... | Authors: | Wang, Y, He, Y, Wang, Y, Yang, Y, Singh, M, Eichhorn, C.D, Zhou, Z.H, Feigon, J. | Deposit date: | 2023-02-23 | Release date: | 2023-06-28 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | Structure of LARP7 Protein p65-telomerase RNA Complex in Telomerase Revealed by Cryo-EM and NMR. J.Mol.Biol., 435, 2023
|
|
2DA8
| SOLUTION STRUCTURE OF A COMPLEX BETWEEN (N-MECYS3,N-MECYS7)TANDEM AND (D(GATATC))2 | Descriptor: | 2-CARBOXYQUINOXALINE, CysMeTANDEM quinoxaline antibiotic, DNA (5'-D(*GP*AP*TP*AP*TP*C)-3') | Authors: | Addess, K.J, Sinsheimer, J.S, Feigon, J. | Deposit date: | 1993-04-09 | Release date: | 1994-01-31 | Last modified: | 2024-08-14 | Method: | SOLUTION NMR | Cite: | Solution Structure of a Complex between [N-Mecys3,N-Mecys7]Tandem and [D(Gatatc)]2. Biochemistry, 32, 1993
|
|
1YMO
| |
156D
| |
1WAN
| DNA DTA TRIPLEX, NMR, 7 STRUCTURES | Descriptor: | DNA (5'-D(*AP*GP*AP*TP*AP*GP*AP*AP*CP*CP*CP*CP*TP*TP*CP*TP*AP*TP*CP*TP*TP*AP*TP*AP*TP*CP*TP*(D3)P*TP*CP*TP*T)-3') | Authors: | Wang, E, Koshlap, K.M, Gillespie, P, Dervan, P.B, Feigon, J. | Deposit date: | 1996-01-14 | Release date: | 1996-07-11 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure of a pyrimidine-purine-pyrimidine triplex containing the sequence-specific intercalating non-natural base D3. J.Mol.Biol., 257, 1996
|
|
3EUD
| Structure of the CS domain of the essential H/ACA RNP assembly protein Shq1p | Descriptor: | Protein SHQ1 | Authors: | Singh, M, Cascio, D, Gonzales, F.A, Heckmann, N, Chanfreau, G, Feigon, J. | Deposit date: | 2008-10-09 | Release date: | 2008-11-18 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure and Functional Studies of the CS Domain of the Essential H/ACA Ribonucleoparticle Assembly Protein SHQ1. J.Biol.Chem., 284, 2009
|
|
2KYE
| Solution structure of the pseudouridine modified P6.1 hairpin of human telomerase RNA | Descriptor: | RNA (5'-R(*GP*AP*GP*AP*GP*(PSU)P*(PSU)P*GP*GP*GP*CP*(PSU)P*CP*(PSU)P*C)-3') | Authors: | Kim, N.-K, Theimer, C.A, Mitchell, J.R, Collins, K, Feigon, J. | Deposit date: | 2010-05-25 | Release date: | 2010-06-30 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Effect of pseudouridylation on the structure and activity of the catalytically essential P6.1 hairpin in human telomerase RNA. Nucleic Acids Res., 38, 2010
|
|
2L1V
| |
2L3E
| Solution structure of P2a-J2a/b-P2b of human telomerase RNA | Descriptor: | 35-MER | Authors: | Zhang, Q, Kim, N, Peterson, R.D, Wang, Z, Feigon, J. | Deposit date: | 2010-09-13 | Release date: | 2010-11-17 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA. Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
5DFM
| Structure of Tetrahymena telomerase p19 fused to MBP | Descriptor: | GLYCEROL, Maltose-binding periplasmic protein,Telomerase-associated protein 19, SULFATE ION, ... | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | Deposit date: | 2015-08-27 | Release date: | 2015-10-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.301 Å) | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science, 350, 2015
|
|
5DFN
| Structure of Tetrahymena Telomerase P45 C-terminal domain | Descriptor: | Telomerase associated protein p45 | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | Deposit date: | 2015-08-27 | Release date: | 2015-10-28 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.382 Å) | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions. Science, 350, 2015
|
|
2K95
| Solution structure of the wild-type P2B-P3 pseudoknot of human telomerase RNA | Descriptor: | Telomerase RNA P2b-P3 pseudoknot | Authors: | Kim, N.-K, Zhang, Q, Zhou, J, Theimer, C.A, Peterson, R.D, Feigon, J. | Deposit date: | 2008-09-29 | Release date: | 2008-11-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution Structure and Dynamics of the Wild-type Pseudoknot of Human Telomerase RNA. J.Mol.Biol., 384, 2008
|
|
185D
| |
148D
| |
5KMZ
| |
7LMA
| Tetrahymena telomerase T3D2 structure at 3.3 Angstrom | Descriptor: | Telomerase La-related protein p65, Telomerase RNA, Telomerase associated protein p50, ... | Authors: | He, Y, Wang, Y, Liu, B, Helmling, C, Susac, L, Cheng, R, Zhou, Z.H, Feigon, J. | Deposit date: | 2021-02-05 | Release date: | 2021-05-12 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Structures of telomerase at several steps of telomere repeat synthesis. Nature, 593, 2021
|
|
7LMB
| Tetrahymena telomerase T5D5 structure at 3.8 Angstrom | Descriptor: | Telomerase La-related protein p65, Telomerase RNA, Telomerase associated protein p50, ... | Authors: | He, Y, Wang, Y, Liu, B, Helmling, C, Susac, L, Cheng, R, Zhou, Z.H, Feigon, J. | Deposit date: | 2021-02-05 | Release date: | 2021-05-12 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | Structures of telomerase at several steps of telomere repeat synthesis. Nature, 593, 2021
|
|