3JRC
 
 | |
3JRI
 | |
3JRG
 | |
3JRE
 | |
5DTD
 | |
5E3L
 | |
5DS9
 | |
5E3N
 | |
5E3O
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
6P0U
 | | Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
6P0T
 | | Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.603 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
6P0S
 | | Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
8P53
 | |
3RQI
 | |
7VBS
 | |
7VBW
 | |
4L4U
 | | Crystal structure of construct containing A. aeolicus NtrC1 receiver, central and DNA binding domains | | Descriptor: | Transcriptional regulator (NtrC family) | | Authors: | Vidangos, N.K, Maris, A.E, Young, A, Hong, E, Pelton, J.G, Batchelor, J.D, Wemmer, D.E. | | Deposit date: | 2013-06-09 | | Release date: | 2013-08-28 | | Last modified: | 2013-10-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure, function, and tethering of DNA-binding domains in sigma (54) transcriptional activators.
Biopolymers, 99, 2013
|
|
1OJL
 | |
5M7O
 | | Crystal structure of NtrX from Brucella abortus processed with the CrystalDirect automated mounting and cryo-cooling technology | | Descriptor: | MAGNESIUM ION, Nitrogen assimilation regulatory protein | | Authors: | Cornaciu, I, Fernandez, I, Hoffmann, G, Carrica, M.C, Goldbaum, F.A, Marquez, J.A. | | Deposit date: | 2016-10-28 | | Release date: | 2017-01-25 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Three-Dimensional Structure of Full-Length NtrX, an Unusual Member of the NtrC Family of Response Regulators.
J. Mol. Biol., 429, 2017
|
|
5M7N
 | | Crystal structure of NtrX from Brucella abortus in complex with ATP processed with the CrystalDirect automated mounting and cryo-cooling technology | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, Nitrogen assimilation regulatory protein | | Authors: | Cornaciu, I, Fernandez, I, Hoffmann, G, Carrica, M.C, Goldbaum, F.A, Marquez, J.A. | | Deposit date: | 2016-10-28 | | Release date: | 2017-01-25 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Three-Dimensional Structure of Full-Length NtrX, an Unusual Member of the NtrC Family of Response Regulators.
J. Mol. Biol., 429, 2017
|
|
5M7P
 | | Crystal structure of NtrX from Brucella abortus in complex with ADP processed with the CrystalDirect automated mounting and cryo-cooling technology | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, Nitrogen assimilation regulatory protein | | Authors: | Cornaciu, I, Fernandez, I, Hoffmann, G, Carrica, M.C, Goldbaum, F.A, Marquez, J.A. | | Deposit date: | 2016-10-28 | | Release date: | 2017-01-25 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.36 Å) | | Cite: | Three-Dimensional Structure of Full-Length NtrX, an Unusual Member of the NtrC Family of Response Regulators.
J. Mol. Biol., 429, 2017
|
|
5EXX
 | | AAA+ ATPase FleQ from Pseudomonas aeruginosa bound to c-di-GMP | | Descriptor: | 9,9'-[(2R,3R,3aS,5S,7aR,9R,10R,10aS,12S,14aR)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecine-2,9-diyl]bis(2-amino-1,9-dihydro-6H-purin-6-one), SULFATE ION, Transcriptional regulator FleQ | | Authors: | Navarro, M.V.A.S, Sondermann, H, Krasteva, P.V. | | Deposit date: | 2015-11-24 | | Release date: | 2016-02-10 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3.311 Å) | | Cite: | Mechanistic insights into c-di-GMP-dependent control of the biofilm regulator FleQ from Pseudomonas aeruginosa.
Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
