1JBD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jbd by Molmil](/molmil-images/mine/1jbd) | NMR Structure of the Complex Between alpha-bungarotoxin and a Mimotope of the Nicotinic Acetylcholine Receptor | Descriptor: | LONG NEUROTOXIN 1, MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | Authors: | Scarselli, M, Spiga, O, Ciutti, A, Bracci, L, Lelli, B, Lozzi, L, Calamandrei, D, Bernini, A, Di Maro, D, Klein, S, Niccolai, N. | Deposit date: | 2001-06-04 | Release date: | 2001-06-27 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1MQZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1mqz by Molmil](/molmil-images/mine/1mqz) | NMR solution structure of type-B lantibiotics mersacidin bound to lipid II in DPC micelles | Descriptor: | LANTIBIOTIC MERSACIDIN | Authors: | Hsu, S.-T, Breukink, E, Bierbaum, G, Sahl, H.-G, de Kruijff, B, Kaptein, R, van Nuland, N.A, Bonvin, A.M. | Deposit date: | 2002-09-17 | Release date: | 2003-03-11 | Last modified: | 2018-08-08 | Method: | SOLUTION NMR | Cite: | NMR Study of Mersacidin and Lipid II Interaction in Dodecylphosphocholine Micelles. Conformational Changes are a Key to Antimicrobial Activity J.Biol.Chem., 278, 2003
|
|
1MQY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1mqy by Molmil](/molmil-images/mine/1mqy) | NMR solution structure of type-B lantibiotics mersacidin in DPC micelles | Descriptor: | LANTIBIOTIC MERSACIDIN | Authors: | Hsu, S.-T, Breukink, E, Bierbaum, G, Sahl, H.-G, de Kruijff, B, Kaptein, R, van Nuland, N.A, Bonvin, A.M. | Deposit date: | 2002-09-17 | Release date: | 2003-03-11 | Last modified: | 2018-08-08 | Method: | SOLUTION NMR | Cite: | NMR Study of Mersacidin and Lipid II Interaction in Dodecylphosphocholine Micelles. Conformational Changes are a Key to Antimicrobial Activity J.Biol.Chem., 278, 2003
|
|
1R7W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7w by Molmil](/molmil-images/mine/1r7w) | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1R7Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7z by Molmil](/molmil-images/mine/1r7z) | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1MQX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1mqx by Molmil](/molmil-images/mine/1mqx) | NMR Solution Structure of Type-B Lantibiotics Mersacidin in MeOH/H2O Mixture | Descriptor: | LANTIBIOTIC MERSACIDIN | Authors: | Hsu, S.-T, Breukink, E, Bierbaum, G, Sahl, H.-G, de Kruijff, B, Kaptein, R, van Nuland, N.A, Bonvin, A.M. | Deposit date: | 2002-09-17 | Release date: | 2003-03-11 | Last modified: | 2018-08-08 | Method: | SOLUTION NMR | Cite: | NMR Study of Mersacidin and Lipid II Interaction in Dodecylphosphocholine Micelles. Conformational Changes are a Key to Antimicrobial Activity J.Biol.Chem., 278, 2003
|
|
1Q9F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q9f by Molmil](/molmil-images/mine/1q9f) | NMR STRUCTURE OF THE OUTER MEMBRANE PROTEIN OMPX IN DHPC MICELLES | Descriptor: | Outer membrane protein X | Authors: | Fernandez, C, Hilty, C, Wider, G, Guntert, P, Wuthrich, K. | Deposit date: | 2003-08-25 | Release date: | 2004-03-23 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR structure of the integral membrane protein OmpX. J.Mol.Biol., 336, 2004
|
|
1ABT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1abt by Molmil](/molmil-images/mine/1abt) | |
1Q5F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q5f by Molmil](/molmil-images/mine/1q5f) | NMR Structure of Type IVb pilin (PilS) from Salmonella typhi | Descriptor: | PilS | Authors: | Xu, X.F, Tan, Y.W, Hackett, J, Zhang, M, Mok, Y.K. | Deposit date: | 2003-08-07 | Release date: | 2004-07-27 | Last modified: | 2022-03-02 | Method: | SOLUTION NMR | Cite: | NMR Structure of a Type IVb Pilin from Salmonella typhi and Its Assembly into Pilus J.Biol.Chem., 279, 2004
|
|
1F6U
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1f6u by Molmil](/molmil-images/mine/1f6u) | NMR structure of the HIV-1 nucleocapsid protein bound to stem-loop sl2 of the psi-RNA packaging signal. Implications for genome recognition | Descriptor: | HIV-1 NUCLEOCAPSID PROTEIN, HIV-1 STEM-LOOP SL2 FROM PSI-RNA PACKAGING, ZINC ION | Authors: | Amarasinghe, G.K, De Guzman, R.N, Turner, R.B, Chancellor, K.J, Summers, M.F. | Deposit date: | 2000-06-23 | Release date: | 2000-10-09 | Last modified: | 2022-02-16 | Method: | SOLUTION NMR | Cite: | NMR structure of the HIV-1 nucleocapsid protein bound to stem-loop SL2 of the psi-RNA packaging signal. Implications for genome recognition. J.Mol.Biol., 301, 2000
|
|
1IK8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ik8 by Molmil](/molmil-images/mine/1ik8) | NMR structure of Alpha-Bungarotoxin | Descriptor: | LONG NEUROTOXIN 1 | Authors: | Niccolai, N, Ciutti, A, Spiga, O. | Deposit date: | 2001-05-03 | Release date: | 2001-05-16 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1P6S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1p6s by Molmil](/molmil-images/mine/1p6s) | Solution Structure of the Pleckstrin Homology Domain of Human Protein Kinase B beta (Pkb/Akt) | Descriptor: | RAC-beta serine/threonine protein kinase | Authors: | Auguin, D, Barthe, P, Auge-Senegas, M.T, Stern, M.H, Noguchi, M, Roumestand, C. | Deposit date: | 2003-04-30 | Release date: | 2004-05-18 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | Solution structure and backbone dynamics of the pleckstrin homology domain of the human
protein kinase B (PKB/Akt). Interaction with inositol phosphates. J.BIOMOL.NMR, 28, 2004
|
|
1RY3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ry3 by Molmil](/molmil-images/mine/1ry3) | NMR Solution Structure of the Precursor for Carnobacteriocin B2, an Antimicrobial Peptide from Carnobacterium piscicola | Descriptor: | Bacteriocin carnobacteriocin B2 | Authors: | Sprules, T, Kawulka, K.E, Gibbs, A.C, Wishart, D.S, Vederas, J.C. | Deposit date: | 2003-12-19 | Release date: | 2004-05-04 | Last modified: | 2022-03-02 | Method: | SOLUTION NMR | Cite: | NMR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide from Carnobacterium piscicola. Eur.J.Biochem., 271, 2004
|
|
1GNF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1gnf by Molmil](/molmil-images/mine/1gnf) | SOLUTION STRUCTURE OF THE N-TERMINAL ZINC FINGER OF MURINE GATA-1, NMR, 25 STRUCTURES | Descriptor: | TRANSCRIPTION FACTOR GATA-1, ZINC ION | Authors: | Kowalski, K, Czolij, R, King, G.F, Crossley, M, Mackay, J.P. | Deposit date: | 1998-10-12 | Release date: | 1999-06-08 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | The solution structure of the N-terminal zinc finger of GATA-1 reveals a specific binding face for the transcriptional co-factor FOG. J.Biomol.NMR, 13, 1999
|
|
1OKD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1okd by Molmil](/molmil-images/mine/1okd) | NMR-structure of tryparedoxin 1 | Descriptor: | TRYPAREDOXIN 1 | Authors: | Krumme, D, Budde, H, Hecht, H.-J, Menge, U, Ohlenschlager, O, Ross, A, Wissing, J, Wray, V, Flohe, L. | Deposit date: | 2003-07-22 | Release date: | 2003-08-28 | Last modified: | 2018-01-17 | Method: | SOLUTION NMR | Cite: | NMR studies of the interaction of tryparedoxin with redox-inactive substrate homologues. Biochemistry, 42, 2003
|
|
1Q9G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1q9g by Molmil](/molmil-images/mine/1q9g) | NMR STRUCTURE OF THE OUTER MEMBRANE PROTEIN OMPX IN DHPC MICELLES | Descriptor: | Outer membrane protein X | Authors: | Fernandez, C, Hilty, C, Wider, G, Guntert, P, Wuthrich, K. | Deposit date: | 2003-08-25 | Release date: | 2004-09-21 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR structure of the integral membrane protein OmpX J.Mol.Biol., 336, 2004
|
|
1RGJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1rgj by Molmil](/molmil-images/mine/1rgj) | NMR STRUCTURE OF THE COMPLEX BETWEEN ALPHA-BUNGAROTOXIN AND MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR WITH ENHANCED ACTIVITY | Descriptor: | MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR, long neurotoxin 1 | Authors: | Bernini, A, Spiga, O, Ciutti, A, Scarselli, M, Bracci, L, Lozzi, L, Lelli, B, Neri, P, Niccolai, N. | Deposit date: | 2003-11-12 | Release date: | 2003-11-25 | Last modified: | 2022-03-02 | Method: | SOLUTION NMR | Cite: | NMR and MD studies on the interaction between ligand peptides and alpha-bungarotoxin. J.Mol.Biol., 339, 2004
|
|
1OW9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ow9 by Molmil](/molmil-images/mine/1ow9) | NMR Structure of the Active Conformation of the VS Ribozyme Cleavage Site | Descriptor: | A mimic of the VS Ribozyme Hairpin Substrate | Authors: | Hoffmann, B, Mitchell, G.T, Gendron, P, Major, F, Andersen, A.A, Collins, R.A, Legault, P. | Deposit date: | 2003-03-28 | Release date: | 2003-05-20 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structure of the Active Conformation of the Varkud satellite Ribozyme Cleavage Site Proc.Natl.Acad.Sci.USA, 100, 2003
|
|
1FU6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fu6 by Molmil](/molmil-images/mine/1fu6) | |
1HOY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1hoy by Molmil](/molmil-images/mine/1hoy) | NMR STRUCTURE OF THE COMPLEX BETWEEN A-BUNGAROTOXIN AND A MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | Descriptor: | LONG NEUROTOXIN 1, MIMOTOPE OF THE NICOTINIC ACETYLCHOLINE RECEPTOR | Authors: | Scarselli, M, Spiga, O, Ciutti, A, Bracci, L, Lelli, B, Lozzi, L, Calamandrei, D, Bernini, A, Di Maro, D, Niccolai, N, Neri, P. | Deposit date: | 2000-12-12 | Release date: | 2000-12-27 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1C56
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1c56 by Molmil](/molmil-images/mine/1c56) | |
1BDZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1bdz by Molmil](/molmil-images/mine/1bdz) | |
1FU5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fu5 by Molmil](/molmil-images/mine/1fu5) | NMR STRUCTURE OF THE N-SH2 DOMAIN OF THE P85 SUBUNIT OF PI3-KINASE COMPLEXED TO A DOUBLY PHOSPHORYLATED PEPTIDE DERIVED FROM POLYOMAVIRUS MIDDLE T ANTIGEN | Descriptor: | DOUBLY PHOSPHORYLATED MIDDLE T ANTIGEN, PHOSPHATIDYLINOSITOL 3-KINASE REGULATORY ALPHA SUBUNIT | Authors: | Weber, T, Schaffhausen, B, Liu, Y, Guenther, U.L. | Deposit date: | 2000-09-14 | Release date: | 2001-02-21 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of the N-SH2 of the p85 subunit of phosphoinositide 3-kinase complexed to a doubly phosphorylated peptide reveals a second phosphotyrosine binding site. Biochemistry, 39, 2000
|
|
1IKC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ikc by Molmil](/molmil-images/mine/1ikc) | NMR Structure of alpha-Bungarotoxin | Descriptor: | long neurotoxin 1 | Authors: | Niccolai, N, Spiga, O, Ciutti, A. | Deposit date: | 2001-05-03 | Release date: | 2001-05-16 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | NMR structure of alpha-bungarotoxin free and bound to a mimotope of the nicotinic acetylcholine receptor. Biochemistry, 41, 2002
|
|
1ONV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1onv by Molmil](/molmil-images/mine/1onv) | NMR Structure of a Complex Containing the TFIIF Subunit RAP74 and the RNAP II CTD Phosphatase FCP1 | Descriptor: | Transcription initiation factor IIF, alpha subunit, serine phosphatase FCP1a | Authors: | Nguyen, B.D, Abbott, K.L, Potempa, K, Kobor, M.S, Archambault, J, Greenblatt, J, Legault, P, Omichinski, J.G. | Deposit date: | 2003-03-02 | Release date: | 2003-05-20 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structure of a Complex Containing the TFIIF Subunit RAP74 and the RNA polymerase II carboxyl-terminal domain phosphatase FCP1 Proc.Natl.Acad.Sci.USA, 100, 2003
|
|