2KVQ
 
 | |
1Q8X
 | | NMR structure of human cofilin | | Descriptor: | Cofilin, non-muscle isoform | | Authors: | Pope, B.J, Zierler-Gould, K.M, Kuhne, R, Weeds, A.G, Ball, L.J. | | Deposit date: | 2003-08-22 | | Release date: | 2004-07-06 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | The solution structure of human cofilin: rationalizing actin binding and pH sensitivity
J.Biol.Chem., 279, 2004
|
|
5X5W
 | | Crystal structure of pseudorabies virus glycoprotein D | | Descriptor: | GD, Nectin-1 | | Authors: | Li, A, Lu, G, Qi, J, Wu, L, Tian, K, Luo, T, Shi, Y, Yan, J, Gao, G.F. | | Deposit date: | 2017-02-17 | | Release date: | 2017-04-26 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structure of pseudorabies virus glycoprotein D
To Be Published
|
|
5X7G
 | | Crystal Structure of Paenibacillus sp. 598K cycloisomaltooligosaccharide glucanotransferase | | Descriptor: | CALCIUM ION, Cycloisomaltooligosaccharide glucanotransferase, GLYCEROL, ... | | Authors: | Fujimoto, Z, Kishine, N, Suzuki, N, Suzuki, R, Momma, M, Funane, K. | | Deposit date: | 2017-02-26 | | Release date: | 2017-04-26 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Isomaltooligosaccharide-binding structure ofPaenibacillussp. 598K cycloisomaltooligosaccharide glucanotransferase
Biosci. Rep., 37, 2017
|
|
6IUB
 | | Structure of Helicobacter pylori Soj protein | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, SpoOJ regulator (Soj) | | Authors: | Chu, C.H, Yen, C.Y, Sun, Y.J. | | Deposit date: | 2018-11-28 | | Release date: | 2019-02-13 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.902 Å) | | Cite: | Crystal structures of HpSoj-DNA complexes and the nucleoid-adaptor complex formation in chromosome segregation.
Nucleic Acids Res., 47, 2019
|
|
1Q9P
 | | Solution structure of the mature HIV-1 protease monomer | | Descriptor: | HIV-1 Protease | | Authors: | Ishima, R, Torchia, D.A, Lynch, S.M, Gronenborn, A.M, Louis, J.M. | | Deposit date: | 2003-08-25 | | Release date: | 2004-03-02 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the mature HIV-1 protease monomer: Insight into the tertiary fold and stability of a precursor
J.Biol.Chem., 278, 2003
|
|
5XCW
 | |
5X7S
 | | Crystal structure of Paenibacillus sp. 598K alpha-1,6-glucosyltransferase, terbium derivative | | Descriptor: | 1,2-ETHANEDIOL, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, CALCIUM ION, ... | | Authors: | Fujimoto, Z, Kishine, N, Suzuki, N, Momma, M, Ichinose, H, Kimura, A, Funane, K. | | Deposit date: | 2017-02-27 | | Release date: | 2017-07-26 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Carbohydrate-binding architecture of the multi-modular alpha-1,6-glucosyltransferase from Paenibacillus sp. 598K, which produces alpha-1,6-glucosyl-alpha-glucosaccharides from starch
Biochem. J., 474, 2017
|
|
5XD3
 | | Crystal structure of Mycobacterium smegmatis MutT1 in complex with ATP (I) | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, GLYCEROL, MAGNESIUM ION, ... | | Authors: | Arif, S.M, Varshney, U, Vijayan, M. | | Deposit date: | 2017-03-24 | | Release date: | 2017-08-09 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.78 Å) | | Cite: | Hydrolysis of diadenosine polyphosphates. Exploration of an additional role of Mycobacterium smegmatis MutT1
J. Struct. Biol., 199, 2017
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
5XDB
 | | Crystal structure of FMN-bound TdsC from Paenibacillus sp. A11-2 | | Descriptor: | FLAVIN MONONUCLEOTIDE, GLYCEROL, SULFATE ION, ... | | Authors: | Hino, T, Hamamoto, H, Ohshiro, T, Nagano, S. | | Deposit date: | 2017-03-28 | | Release date: | 2017-08-09 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.811 Å) | | Cite: | Crystal structures of TdsC, a dibenzothiophene monooxygenase from the thermophile Paenibacillus sp. A11-2, reveal potential for expanding its substrate selectivity.
J. Biol. Chem., 292, 2017
|
|
1QCD
 | | CRYSTAL STRUCTURES OF ADENINE PHOSPHORIBOSYLTRANSFERASE FROM LEISHMANIA DONOVANI | | Descriptor: | ADENINE PHOSPHORIBOSYLTRANSFERASE, SULFATE ION | | Authors: | Phillips, C.L, Ullman, B, Brennan, R.G, Hill, C.P. | | Deposit date: | 1999-05-01 | | Release date: | 1999-07-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.48 Å) | | Cite: | Crystal structures of adenine phosphoribosyltransferase from Leishmania donovani.
EMBO J., 18, 1999
|
|
5X8Z
 | |
6I3I
 | |
1QD2
 | |
6I4P
 | | Crystal structure of the disease-causing G194C mutant of the human dihydrolipoamide dehydrogenase | | Descriptor: | 2-[BIS-(2-HYDROXY-ETHYL)-AMINO]-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Dihydrolipoyl dehydrogenase, mitochondrial, ... | | Authors: | Szabo, E, Wilk, P, Torocsik, B, Weiss, M.S, Adam-Vizi, V, Ambrus, A. | | Deposit date: | 2018-11-10 | | Release date: | 2019-11-20 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Underlying molecular alterations in human dihydrolipoamide dehydrogenase deficiency revealed by structural analyses of disease-causing enzyme variants.
Hum.Mol.Genet., 28, 2019
|
|
5XAV
 | | Structure of PhaC from Chromobacterium sp. USM2 | | Descriptor: | Intracellular polyhydroxyalkanoate synthase | | Authors: | Chek, M.F, Kim, S.Y, Mori, T, Arsad, H, Samian, M.R, Sudesh, K, Hakoshima, T. | | Deposit date: | 2017-03-15 | | Release date: | 2017-07-26 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (1.479 Å) | | Cite: | Structure of polyhydroxyalkanoate (PHA) synthase PhaC from Chromobacterium sp. USM2, producing biodegradable plastics
Sci Rep, 7, 2017
|
|
5XBJ
 | |
1QXQ
 | |
1QEX
 | | BACTERIOPHAGE T4 GENE PRODUCT 9 (GP9), THE TRIGGER OF TAIL CONTRACTION AND THE LONG TAIL FIBERS CONNECTOR | | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, PROTEIN (BACTERIOPHAGE T4 GENE PRODUCT 9 (GP9)) | | Authors: | Kostyuchenko, V.A, Navruzbekov, G.A, Kurochkina, L.P, Strelkov, S.V, Mesyanzhinov, V.V, Rossmann, M.G. | | Deposit date: | 1999-03-30 | | Release date: | 1999-10-05 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | The structure of bacteriophage T4 gene product 9: the trigger for tail contraction.
Structure Fold.Des., 7, 1999
|
|
6I5O
 | |
5XFV
 | | Crystal structures of FMN-bound form of dihydroorotate dehydrogenase from Trypanosoma brucei | | Descriptor: | Dihydroorotate dehydrogenase (fumarate), FLAVIN MONONUCLEOTIDE, MALONATE ION | | Authors: | Kubota, T, Tani, O, Yamaguchi, T, Namatame, I, Sakashita, H, Furukawa, K, Yamasaki, K. | | Deposit date: | 2017-04-11 | | Release date: | 2018-04-25 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.79 Å) | | Cite: | Crystal structures of FMN-bound and FMN-free forms of dihydroorotate dehydrogenase fromTrypanosoma brucei.
FEBS Open Bio, 8, 2018
|
|
6I60
 | | Structure of alpha-L-rhamnosidase from Dictyoglumus thermophilum | | Descriptor: | 2-(2-ETHOXYETHOXY)ETHANOL, Alpha-rhamnosidase, TRIETHYLENE GLYCOL | | Authors: | Lafite, P, Daniellou, R. | | Deposit date: | 2018-11-15 | | Release date: | 2019-02-06 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.743 Å) | | Cite: | Biochemical Characterization of the alpha-l-RhamnosidaseDtRha fromDictyoglomus thermophilum: Application to the Selective Derhamnosylation of Natural Flavonoids.
Acs Omega, 4, 2019
|
|
1QXZ
 | | Crystal structure of S. aureus methionine aminopeptidase in complex with a ketoheterocycle inhibitor 119 | | Descriptor: | (2S)-2-AMINO-4-(METHYLSULFANYL)-1-(1,3-THIAZOL-2-YL)BUTANE-1,1-DIOL, COBALT (II) ION, methionyl aminopeptidase | | Authors: | Douangamath, A, Dale, G.E, D'Arcy, A, Oefner, C. | | Deposit date: | 2003-09-09 | | Release date: | 2004-03-16 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.68 Å) | | Cite: | Crystal structures of staphylococcusaureus methionine aminopeptidase complexed with keto heterocycle and aminoketone inhibitors reveal the formation of a tetrahedral intermediate.
J.Med.Chem., 47, 2004
|
|
1QGV
 | | HUMAN SPLICEOSOMAL PROTEIN U5-15KD | | Descriptor: | SPLICEOSOMAL PROTEIN U5-15KD | | Authors: | Reuter, K, Nottrott, S, Fabrizio, P, Luehrmann, R, Ficner, R. | | Deposit date: | 1999-05-06 | | Release date: | 1999-12-12 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Identification, characterization and crystal structure analysis of the human spliceosomal U5 snRNP-specific 15 kD protein.
J.Mol.Biol., 294, 1999
|
|
