PDB: 20503 resultsInfo pagesStatus searchChemie searchBIRD

---

2MHF	Solution structure of the cyclic-nucleotide binding homology domain of a KCNH channel Descriptor: Uncharacterized protein Authors: Li, Q, Ng, H. Deposit date: 2013-11-21 Release date: 2014-04-02 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Solution structure of the cyclic-nucleotide binding homology domain of a KCNH channel. J.Struct.Biol., 186, 2014
2M6W	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions Descriptor: DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') Authors: Karsisiotis, A.I, Webba da Silva, M. Deposit date: 2013-04-19 Release date: 2014-07-23 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
2M3O	Structure and dynamics of a human Nedd4 WW domain-ENaC complex Descriptor: Amiloride-sensitive sodium channel subunit alpha, E3 ubiquitin-protein ligase NEDD4 Authors: Bobby, R, Medini, K, Neudecker, P, Lee, V, MacDonald, F.J, Brimble, M.A, Lott, J, Dingley, A.J. Deposit date: 2013-01-23 Release date: 2013-08-28 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structure and dynamics of human Nedd4-1 WW3 in complex with the alpha ENaC PY motif. Biochim.Biophys.Acta, 1834, 2013
2MBE	Backbone 1H and 15N Chemical Shift Assignments for the first domain of FAT10 Descriptor: Ubiquitin D Authors: Wang, W, Lim, L, Qin, H. Deposit date: 2013-07-30 Release date: 2014-08-27 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Disruption of FAT10-MAD2 binding inhibits tumor progression. Proc.Natl.Acad.Sci.USA, 111, 2014
2M3N	Peptide leucine arginine Descriptor: Peptide leucine arginine Authors: Polte, T. Deposit date: 2013-01-23 Release date: 2013-09-11 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Therapeutic potential of the Peptide leucine arginine as a new nonplant bowman-birk-like serine protease inhibitor. J.Med.Chem., 56, 2013
2MKF	Solution structure of the E81 deletion mutant of the tandem UIMs of RAP80 Descriptor: BRCA1-A complex subunit RAP80 Authors: Anamika, Markin, C.J, Rout, M.K, Spyracopoulos, L. Deposit date: 2014-02-06 Release date: 2014-03-19 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Molecular Basis for Impaired DNA Damage Response Function Associated with the RAP80 Delta E81 Defect. J.Biol.Chem., 289, 2014
2CKU	Solution structure of 2F13F1 from human fibronectin Descriptor: FIBRONECTIN Authors: Werner, J.M, Potts, J.R. Deposit date: 2006-04-21 Release date: 2007-04-03 Last modified: 2021-06-23 Method: SOLUTION NMR Cite: The Solution and Crystal Structures of a Module Pair from the Staphylococcus Aureus-Binding Site of Human Fibronectin-A Tale with a Twist. J.Mol.Biol., 368, 2007
2M6V	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions Descriptor: DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3') Authors: Karsisiotis, A.I, Webba da Silva, M. Deposit date: 2013-04-10 Release date: 2014-07-16 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
2LY6	Refined solution structure of recombinant brazzein at low temperature Descriptor: Defensin-like protein Authors: Cornilescu, C.C, Cornilescu, G, Tonelli, M, Markley, J.L, Assadi-Porter, F.M. Deposit date: 2012-09-12 Release date: 2012-10-17 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Temperature-dependent conformational change affecting Tyr11 and sweetness loops of brazzein. Proteins, 81, 2013
2MAB	Untangling the Solution Structure of C-Terminal Domain of Aciniform Spidroin Descriptor: ACINIFORM SPIDROIN Authors: Wang, S, Yang, D. Deposit date: 2013-07-09 Release date: 2014-03-05 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structure and function of C-terminal domain of aciniform spidroin Biomacromolecules, 15, 2014
2LXO	Identification of the Structural Traits Mediating the Antimicrobial Activity of a Chimeric Peptide of HBD2 and HBD3 Descriptor: Chimeric Peptide Authors: Spudy, B, Soennichsen, F.D, Waetzig, G.H, Grotzinger, J, Jung, S. Deposit date: 2012-08-30 Release date: 2013-08-14 Last modified: 2023-12-13 Method: SOLUTION NMR Cite: Identification of structural traits that increase the antimicrobial activity of a chimeric peptide of human beta-defensins 2 and 3. Biochem.Biophys.Res.Commun., 427, 2012
2LY5	Refined solution structure of recombinant brazzein Descriptor: Defensin-like protein Authors: Cornilescu, C.C, Cornilescu, G, Tonelli, M, Markley, J.L, Assadi-Porter, F.M. Deposit date: 2012-09-12 Release date: 2013-01-30 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Temperature-dependent conformational change affecting Tyr11 and sweetness loops of brazzein. Proteins, 81, 2013
2M12	Solution structure of the ID3 stem loop of domain 1 of the ai5gamma group II intron Descriptor: RNA (5'-R(*GP*GP*GP*UP*GP*UP*AP*UP*UP*GP*GP*AP*AP*AP*UP*GP*AP*GP*CP*AP*CP*CP*C)-3') Authors: Popovic, M, Greenbaum, N.L. Deposit date: 2012-11-13 Release date: 2013-10-23 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Role of helical constraints of the EBS1-IBS1 duplex of a group II intron on demarcation of the 5' splice site. Rna, 20, 2014
2MRM	Solution structure of the rhodanese domain of YgaP from E. coli Descriptor: Membrane protein Authors: Wang, W, Zhou, P, Tian, C, Wu, F. Deposit date: 2014-07-12 Release date: 2014-10-08 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Fast conformational exchange between the sulfur-free and persulfide-bound rhodanese domain of E. coli YgaP Biochem.Biophys.Res.Commun., 452, 2014
2MY2	Snu17p-Bud13p structure intermediate during RES complex assembly Descriptor: Pre-mRNA-splicing factor CWC26, U2 snRNP component IST3 Authors: Wysoczanski, P, Becker, S, Zweckstetter, M. Deposit date: 2015-01-19 Release date: 2015-08-12 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structures of intermediates during RES complex assembly. Sci Rep, 5, 2015
2MV6	Solution structure of the transmembrane domain and the juxta-membrane domain of the Erythropoietin Receptor in micelles Descriptor: Erythropoietin receptor Authors: Li, Q, Wong, Y, Huang, Q, Kang, C. Deposit date: 2014-09-23 Release date: 2014-12-10 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural insight into the transmembrane domain and the juxtamembrane region of the erythropoietin receptor in micelles. Biophys.J., 107, 2014
2MVZ	Solution Structure for Cyclophilin A from Geobacillus Kaustophilus Descriptor: Peptidyl-prolyl cis-trans isomerase Authors: Holliday, M.J, Isern, N.G, Geoffrey, A.S, Zhang, F, Eisenmesser, E.Z. Deposit date: 2014-10-20 Release date: 2015-07-08 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structure and Dynamics of GeoCyp: A Thermophilic Cyclophilin with a Novel Substrate Binding Mechanism That Functions Efficiently at Low Temperatures. Biochemistry, 54, 2015
2MR8	holo structure of the Peptidyl Carrier Protein Domain 7 of the teicoplanin producing Non-ribosomal peptide synthetase Descriptor: Non-ribosomal peptide synthetase Authors: Haslinger, K, Maximowitsch, E, Redfield, C, Cryle, M.J. Deposit date: 2014-07-02 Release date: 2015-01-28 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structure of the terminal PCP domain of the non-ribosomal peptide synthetase in teicoplanin biosynthesis. Proteins, 83, 2015
2NAE	Membrane-bound mouse CD28 cytoplasmic tail Descriptor: T-cell-specific surface glycoprotein CD28 Authors: Li, H, Xu, C, Pan, W. Deposit date: 2015-12-23 Release date: 2016-12-21 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Dynamic regulation of CD28 conformation and signaling by charged lipids and ions. Nat.Struct.Mol.Biol., 24, 2017
2MR3	A subunit of 26S proteasome lid complex Descriptor: 26S proteasome regulatory subunit RPN9 Authors: Wu, Y, Hu, Y, Jin, C. Deposit date: 2014-06-30 Release date: 2015-02-04 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution structure of yeast Rpn9: insights into proteasome lid assembly. J. Biol. Chem., 290, 2015
2MQW	Solution structure of a proteasome related subunit N terminal domain Descriptor: 26S proteasome regulatory subunit RPN9 Authors: Wu, Y, Hu, Y, Jin, C. Deposit date: 2014-06-30 Release date: 2015-02-04 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution structure of yeast Rpn9: insights into proteasome lid assembly. J. Biol. Chem., 290, 2015
2MVJ	Structure of Stage V sporulation protein M (SpoVM) P9A mutant Descriptor: Stage V sporulation protein M Authors: Tian, F, Gill Jr, R. Deposit date: 2014-10-07 Release date: 2015-04-01 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural basis for the geometry-driven localization of a small protein. Proc.Natl.Acad.Sci.USA, 112, 2015
2MP2	Solution structure of SUMO dimer in complex with SIM2-3 from RNF4 Descriptor: E3 ubiquitin-protein ligase RNF4, Small ubiquitin-related modifier 3 Authors: Xu, Y, Plechanovov, A, Simpson, P, Marchant, J, Leidecker, O, Sebastian, K, Hay, R.T, Matthews, S.J. Deposit date: 2014-05-09 Release date: 2014-07-02 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural insight into SUMO chain recognition and manipulation by the ubiquitin ligase RNF4. Nat Commun, 5, 2014
2N4L	Solution Structure of the HIV-1 Intron Splicing Silencer and its Interactions with the UP1 Domain of hnRNP A1 Descriptor: RNA (53-MER) Authors: Tolbert, B.S, Jain, N, Morgan, C.E, Rife, B.D, Salemi, M. Deposit date: 2015-06-23 Release date: 2015-12-02 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1. J.Biol.Chem., 291, 2016
2NX6	Structure of NOWA cysteine rich domain 6 Descriptor: Nematocyst outer wall antigen Authors: Meier, S, Jensen, P.R, Adamczyk, P, Bachinger, H.P, Holstein, T.W, Engel, J, Ozbek, S, Grzesiek, S. Deposit date: 2006-11-17 Release date: 2007-10-02 Last modified: 2023-12-27 Method: SOLUTION NMR Cite: Sequence-structure and structure-function analysis in cysteine-rich domains forming the ultrastable nematocyst wall. J.Mol.Biol., 368, 2007

<304305306307308309310311312313314315316317318319>