5DU3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5du3 by Molmil](/molmil-images/mine/5du3) | Active form of human C1-inhibitor | Descriptor: | Plasma protease C1 inhibitor | Authors: | Pannu, N.S, Dijk, M, Holkers, J, Voskamp, P, Giannetti, B.M, Waterreus, W.J, van Veen, H.A. | Deposit date: | 2015-09-18 | Release date: | 2016-08-31 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | How Dextran Sulfate Affects C1-inhibitor Activity: A Model for Polysaccharide Potentiation. Structure, 24, 2016
|
|
5DUQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5duq by Molmil](/molmil-images/mine/5duq) | Active human c1-inhibitor in complex with dextran sulfate | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Plasma protease C1 inhibitor, SULFITE ION, ... | Authors: | Dijk, M, Holkers, J, Voskamp, P, Giannetti, B.M, Waterreus, W.J, van Veen, H.A, Pannu, N.S. | Deposit date: | 2015-09-20 | Release date: | 2016-08-31 | Last modified: | 2020-07-29 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | How Dextran Sulfate Affects C1-inhibitor Activity: A Model for Polysaccharide Potentiation. Structure, 24, 2016
|
|
1DXW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1dxw by Molmil](/molmil-images/mine/1dxw) | structure of hetero complex of non structural protein (NS) of hepatitis C virus (HCV) and synthetic peptidic compound | Descriptor: | N-(tert-butoxycarbonyl)-L-alpha-glutamyl-N-[(1R)-1-(carboxycarbonyl)-3,3-difluoropropyl]-L-leucinamide, SERINE PROTEASE, ZINC ION | Authors: | Barbato, G, Cicero, D.O, Cordier, F, Narjes, F, Gerlach, B, Sambucini, S, Grzesiek, S, Matassa, V.G, Defrancesco, R, Bazzo, R. | Deposit date: | 2000-01-17 | Release date: | 2001-01-12 | Last modified: | 2020-01-15 | Method: | SOLUTION NMR | Cite: | Inhibitor Binding Induces Active Site Stabilisation of the Hcv Ns3 Protein Serine Protease Domain Embo J., 19, 2000
|
|
1ESE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ese by Molmil](/molmil-images/mine/1ese) | THE MOLECULAR MECHANISM OF ENANTIORECOGNITION BY ESTERASES | Descriptor: | DIETHYL PHOSPHONATE, ESTERASE | Authors: | Wei, Y, Schottel, J.L, Derewenda, U, Swenson, L, Patkar, S, Derewenda, Z.S. | Deposit date: | 1994-10-07 | Release date: | 1995-10-15 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | A novel variant of the catalytic triad in the Streptomyces scabies esterase. Nat.Struct.Biol., 2, 1995
|
|
1ESD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1esd by Molmil](/molmil-images/mine/1esd) | THE MOLECULAR MECHANISM OF ENANTIORECOGNITION BY ESTERASES | Descriptor: | ESTERASE, METHYLPHOSPHONIC ACID ESTER GROUP | Authors: | Wei, Y, Schottel, J.L, Derewenda, U, Swenson, L, Patkar, S, Derewenda, Z.S. | Deposit date: | 1994-10-07 | Release date: | 1995-10-15 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A novel variant of the catalytic triad in the Streptomyces scabies esterase. Nat.Struct.Biol., 2, 1995
|
|
1FG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ffz by Molmil](/molmil-images/mine/1ffz) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
6UJI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uji by Molmil](/molmil-images/mine/6uji) | |
9CYS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 9cys by Molmil](/molmil-images/mine/9cys) | Toxin/immunity complex for a T6SS lipase effector from E. cloacae | Descriptor: | Ankyrin repeat domain-containing protein, CITRIC ACID, GLYCEROL, ... | Authors: | Cuthbert, B.J, Jensen, S.J, Goulding, C.W, Hayes, C.S. | Deposit date: | 2024-08-02 | Release date: | 2024-08-14 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Advanced glycation end-product (AGE) crosslinking activates a type 6 secretion system phospholipase effector protein Nature Communications, 2024
|
|
6AZP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6azp by Molmil](/molmil-images/mine/6azp) | |
4QT6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4qt6 by Molmil](/molmil-images/mine/4qt6) | Crystal structure of the SPRY domain of human HERC1 | Descriptor: | FORMAMIDE, Probable E3 ubiquitin-protein ligase HERC1, UNKNOWN ATOM OR ION | Authors: | Dong, A, Hu, J, Guan, X, Wernimont, A, Li, Y, Bountra, C, Arrowsmith, C.H, Edwards, A.M, Tong, Y, Structural Genomics Consortium (SGC) | Deposit date: | 2014-07-07 | Release date: | 2015-01-07 | Last modified: | 2017-11-22 | Method: | X-RAY DIFFRACTION (1.64 Å) | Cite: | Crystal structure of the SPRY domain of human HERC1 To be Published
|
|
6UZB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uzb by Molmil](/molmil-images/mine/6uzb) | Anthrax toxin protective antigen channels bound to edema factor | Descriptor: | CALCIUM ION, Calmodulin-sensitive adenylate cyclase, Protective antigen | Authors: | Hardenbrook, N.J, Liu, S, Zhou, K, Zhou, Z.H, Krantz, B.A. | Deposit date: | 2019-11-14 | Release date: | 2020-03-04 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Atomic structures of anthrax toxin protective antigen channels bound to partially unfolded lethal and edema factors. Nat Commun, 11, 2020
|
|
4RD8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4rd8 by Molmil](/molmil-images/mine/4rd8) | The crystal structure of a functionally-unknown protein from Legionella pneumophila subsp. pneumophila str. Philadelphia 1 | Descriptor: | Uncharacterized protein | Authors: | Tan, K, Xu, X, Cui, H, Savchenko, A, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2014-09-18 | Release date: | 2014-10-01 | Last modified: | 2017-11-22 | Method: | X-RAY DIFFRACTION (1.72 Å) | Cite: | The crystal structure of a functionally-unknown protein from Legionella pneumophila subsp. pneumophila str. Philadelphia 1 To be Published
|
|
6UZD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uzd by Molmil](/molmil-images/mine/6uzd) | Anthrax toxin protective antigen channels bound to edema factor | Descriptor: | CALCIUM ION, Calmodulin-sensitive adenylate cyclase, Protective antigen | Authors: | Hardenbrook, N.J, Liu, S, Zhou, K, Zhou, Z.H, Krantz, B.A. | Deposit date: | 2019-11-14 | Release date: | 2020-03-04 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Atomic structures of anthrax toxin protective antigen channels bound to partially unfolded lethal and edema factors. Nat Commun, 11, 2020
|
|
6UZE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uze by Molmil](/molmil-images/mine/6uze) | Anthrax toxin protective antigen channels bound to edema factor | Descriptor: | CALCIUM ION, Calmodulin-sensitive adenylate cyclase, Protective antigen | Authors: | Hardenbrook, N.J, Liu, S, Zhou, K, Zhou, Z.H, Krantz, B.A. | Deposit date: | 2019-11-15 | Release date: | 2020-03-04 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Atomic structures of anthrax toxin protective antigen channels bound to partially unfolded lethal and edema factors. Nat Commun, 11, 2020
|
|
4O9K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4o9k by Molmil](/molmil-images/mine/4o9k) | Crystal structure of the CBS pair of a putative D-arabinose 5-phosphate isomerase from Methylococcus capsulatus in complex with CMP-Kdo | Descriptor: | Arabinose 5-phosphate isomerase, CYTIDINE 5'-MONOPHOSPHATE 3-DEOXY-BETA-D-GULO-OCT-2-ULO-PYRANOSONIC ACID, GLYCEROL | Authors: | Shabalin, I.G, Cooper, D.R, Shumilin, I.A, Zimmerman, M.D, Majorek, K.A, Hammonds, J, Hillerich, B.S, Nawar, A, Bonanno, J, Seidel, R, Almo, S.C, Minor, W, New York Structural Genomics Research Consortium (NYSGRC) | Deposit date: | 2014-01-02 | Release date: | 2014-01-22 | Last modified: | 2022-04-13 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | Crystal structure and kinetic properties of D-arabinose 5-phosphate isomerase from Methylococcus capsulatus To be Published
|
|
7VYZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7vyz by Molmil](/molmil-images/mine/7vyz) | Structure of the M. tuberculosis HtrA S367A mutant | Descriptor: | Probable serine protease HtrA1 | Authors: | Gupta, A.K, Gopal, B. | Deposit date: | 2021-11-15 | Release date: | 2022-11-23 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.401 Å) | Cite: | Allosteric Determinants in High Temperature Requirement A Enzymes Are Conserved and Regulate the Population of Active Conformations. Acs Chem.Biol., 18, 2023
|
|
6BHX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6bhx by Molmil](/molmil-images/mine/6bhx) | B. subtilis SsbA with DNA | Descriptor: | DNA (5'-D(P*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*T)-3'), Single-stranded DNA-binding protein A | Authors: | Dubiel, K.D, Myers, A.R, Satyshur, K.A, Keck, J.L. | Deposit date: | 2017-10-31 | Release date: | 2018-12-19 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.936 Å) | Cite: | Structural Mechanisms of Cooperative DNA Binding by Bacterial Single-Stranded DNA-Binding Proteins. J. Mol. Biol., 431, 2019
|
|
6PSN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6psn by Molmil](/molmil-images/mine/6psn) | Anthrax toxin protective antigen channels bound to lethal factor | Descriptor: | CALCIUM ION, Lethal factor, Protective antigen | Authors: | Hardenbrook, N.J, Liu, S, Zhou, K, Zhou, Z.H, Krantz, B.A. | Deposit date: | 2019-07-12 | Release date: | 2020-03-04 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (4.6 Å) | Cite: | Atomic structures of anthrax toxin protective antigen channels bound to partially unfolded lethal and edema factors. Nat Commun, 11, 2020
|
|
5ULC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ulc by Molmil](/molmil-images/mine/5ulc) | PLASMODIUM FALCIPARUM BROMODOMAIN-CONTAINING PROTEIN PF10_0328 | Descriptor: | Bromodomain protein 1 | Authors: | Wernimont, A.K, Amaya, M.F, Lam, A, Ali, A, Zhang, A.Z, Kenzina, L, Lin, Y.H, MacKenzie, F, Kozieradzki, I, Cossar, D, Schapira, M, Bochkarev, A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Weigelt, J, Hui, R, Walker, J.R, Qiu, W, Brand, V, Structural Genomics Consortium (SGC) | Deposit date: | 2017-01-24 | Release date: | 2017-02-22 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | PLASMODIUM FALCIPARUM BROMODOMAIN-CONTAINING PROTEIN PF10_0328 To be published
|
|
6BHW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6bhw by Molmil](/molmil-images/mine/6bhw) | B. subtilis SsbA | Descriptor: | 1,2-ETHANEDIOL, DI(HYDROXYETHYL)ETHER, Single-stranded DNA-binding protein A | Authors: | Dubiel, K.D, Myers, A.R, Satyshur, K.A, Keck, J.L. | Deposit date: | 2017-10-31 | Release date: | 2018-12-19 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.208 Å) | Cite: | Structural Mechanisms of Cooperative DNA Binding by Bacterial Single-Stranded DNA-Binding Proteins. J. Mol. Biol., 431, 2019
|
|
5VGM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5vgm by Molmil](/molmil-images/mine/5vgm) | Crystal structure of dihydroorotase pyrC from Vibrio cholerae in complex with zinc at 1.95 A resolution. | Descriptor: | ACETATE ION, CHLORIDE ION, Dihydroorotase, ... | Authors: | Lipowska, J, Shabalin, I.G, Miks, C.D, Winsor, J, Cooper, D.R, Shuvalova, L, Kwon, K, Lewinski, K, Anderson, W.F, Minor, W, Center for Structural Genomics of Infectious Diseases (CSGID) | Deposit date: | 2017-04-11 | Release date: | 2017-04-26 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | Pyrimidine biosynthesis in pathogens - Structures and analysis of dihydroorotases from Yersinia pestis and Vibrio cholerae. Int.J.Biol.Macromol., 136, 2019
|
|
6IEO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ieo by Molmil](/molmil-images/mine/6ieo) | |
6VRA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6vra by Molmil](/molmil-images/mine/6vra) | Anthrax octamer prechannel bound to full-length edema factor | Descriptor: | CALCIUM ION, Calmodulin-sensitive adenylate cyclase, Protective antigen | Authors: | Zhou, K, Hardenbrook, N.J, Liu, S, Cui, Y.X, Krantz, B.A, Zhou, Z.H. | Deposit date: | 2020-02-07 | Release date: | 2020-12-16 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Atomic Structures of Anthrax Prechannel Bound with Full-Length Lethal and Edema Factors. Structure, 28, 2020
|
|
6CJ7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6cj7 by Molmil](/molmil-images/mine/6cj7) | Crystal structure of Manduca sexta Serine protease inhibitor (Serpin)-12 | Descriptor: | Serpin-12 | Authors: | Gulati, M, Hu, Y, Peng, S, Pathak, P.K, Wang, Y, Deng, J, Jiang, H. | Deposit date: | 2018-02-26 | Release date: | 2018-07-04 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Manduca sexta serpin-12 controls the prophenoloxidase activation system in larval hemolymph. Insect Biochem. Mol. Biol., 99, 2018
|
|