1IU3
 
 | | CRYSTAL STRUCTURE OF THE E.COLI SEQA PROTEIN COMPLEXED WITH HEMIMETHYLATED DNA | | Descriptor: | 5'-D(*AP*AP*GP*GP*AP*TP*CP*CP*AP*A)-3', 5'-D(*TP*TP*GP*GP*AP*TP*CP*CP*TP*T)-3', SeqA protein | | Authors: | Fujikawa, N, Kurumizaka, H, Nureki, O, Tanaka, Y, Yamazoe, M, Hiraga, S, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | | Deposit date: | 2002-02-26 | | Release date: | 2003-06-17 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structural and biochemical analyses of hemimethylated DNA binding by the SeqA protein.
Nucleic Acids Res., 32, 2004
|
|
1IE2
 | | Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1IR2
 | | Crystal Structure of Activated Ribulose-1,5-bisphosphate Carboxylase/oxygenase (Rubisco) from Green alga, Chlamydomonas reinhardtii Complexed with 2-Carboxyarabinitol-1,5-bisphosphate (2-CABP) | | Descriptor: | 2-CARBOXYARABINITOL-1,5-DIPHOSPHATE, GLYCEROL, Large subunit of Rubisco, ... | | Authors: | Mizohata, E, Matsumura, H, Okano, Y, Kumei, M, Takuma, H, Onodera, J, Kato, K, Shibata, N, Inoue, T, Yokota, A, Kai, Y. | | Deposit date: | 2001-09-03 | | Release date: | 2002-03-20 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (1.84 Å) | | Cite: | Crystal structure of activated ribulose-1,5-bisphosphate carboxylase/oxygenase from green alga Chlamydomonas reinhardtii complexed with 2-carboxyarabinitol-1,5-bisphosphate.
J.Mol.Biol., 316, 2002
|
|
1J3T
 | | Solution structure of the second SH3 domain of human intersectin 2 (KIAA1256) | | Descriptor: | Intersectin 2 | | Authors: | Nameki, N, Koshiba, S, Tochio, N, Kobayashi, N, Inoue, M, Kigawa, T, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | | Deposit date: | 2003-02-13 | | Release date: | 2004-06-15 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the second SH3 domain of human intersectin 2 (KIAA1256)
To be Published
|
|
1Q6A
 | | Solution Structure of the C-terminal Domain of Thermosynechococcus elongatus KaiA (ThKaiA180C); Averaged Minimized Structure | | Descriptor: | Circadian clock protein KaiA homolog | | Authors: | Vakonakis, I, Sun, J, Holzenburg, A, Golden, S.S, LiWang, A.C. | | Deposit date: | 2003-08-13 | | Release date: | 2003-08-19 | | Last modified: | 2011-07-13 | | Method: | SOLUTION NMR | | Cite: | NMR structure of the KaiC-interacting C-terminal domain of KaiA, a circadian clock protein: Implications for KaiA-KaiC interaction
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1J89
 | | HUMAN HIGH AFFINITY FC RECEPTOR FC(EPSILON)RI(ALPHA), TETRAGONAL CRYSTAL FORM 2 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, HIGH AFFINITY IMMUNOGLOBULIN EPSILON RECEPTOR ALPHA-SUBUNIT, ... | | Authors: | Garman, S.C, Sechi, S, Kinet, J.P, Jardetzky, T.S. | | Deposit date: | 2001-05-20 | | Release date: | 2001-08-29 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (4.1 Å) | | Cite: | The analysis of the human high affinity IgE receptor Fc epsilon Ri alpha from multiple crystal forms.
J.Mol.Biol., 311, 2001
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
2BEU
 | | Reactivity modulation of human branched-chain alpha-ketoacid dehydrogenase by an internal molecular switch | | Descriptor: | 2-OXOISOVALERATE DEHYDROGENASE ALPHA SUBUNIT, 2-OXOISOVALERATE DEHYDROGENASE BETA SUBUNIT, C2-1-HYDROXY-3-METHYL-PROPYL-THIAMIN DIPHOSPHATE, ... | | Authors: | Machius, M, Wynn, R.M, Chuang, J.L, Tomchick, D.R, Brautigam, C.A, Chuang, D.T. | | Deposit date: | 2004-11-30 | | Release date: | 2006-02-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | A Versatile Conformational Switch Regulates Reactivity in Human Branched-Chain Alpha-Ketoacid Dehydrogenase.
Structure, 14, 2006
|
|
2BV9
 | | HOW FAMILY 26 GLYCOSIDE HYDROLASES ORCHESTRATE CATALYSIS ON DIFFERENT POLYSACCHARIDES. STRUCTURE AND ACTIVITY OF A CLOSTRIDIUM THERMOCELLUM LICHENASE, CtLIC26A | | Descriptor: | ENDOGLUCANASE H | | Authors: | Taylor, E.J, Goyal, A, Guerreiro, C.I.P.D, Prates, J.A.M, Money, V.A, Ferry, N, Morland, C, Planas, A, Macdonald, J.A, Stick, R.V, Gilbert, H.J, Fontes, C.M.G.A, Davies, G.J. | | Deposit date: | 2005-06-23 | | Release date: | 2005-06-30 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | How Family 26 Glycoside Hydrolases Orchestrate Catalysis on Different Polysaccharides: Structure and Activity of a Clostridium Thermocellum Lichenase, Ctlic26A.
J.Biol.Chem., 280, 2005
|
|
1Q8Z
 | | The apoenzyme structure of the yeast SR protein kinase, Sky1p | | Descriptor: | 1,2-ETHANEDIOL, METHANOL, SR Protein Kinase, ... | | Authors: | Nolen, B, Ngo, J, Chakrabarti, S, Vu, D, Adams, J.A, Ghosh, G. | | Deposit date: | 2003-08-22 | | Release date: | 2003-09-23 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Nucleotide-Induced Conformational Changes in the Saccharomyces cerevisiae SR Protein Kinase, Sky1p, Revealed by X-Ray Crystallography
Biochemistry, 42, 2003
|
|
2BEW
 | | Reactivity modulation of human branched-chain alpha-ketoacid dehydrogenase by an internal molecular switch | | Descriptor: | 2-OXOISOVALERATE DEHYDROGENASE ALPHA SUBUNIT, 2-OXOISOVALERATE DEHYDROGENASE BETA SUBUNIT, C2-1-HYDROXYPHENYL-THIAMIN DIPHOSPHATE, ... | | Authors: | Machius, M, Wynn, R.M, Chuang, J.L, Tomchick, D.R, Brautigam, C.A, Chuang, D.T. | | Deposit date: | 2004-11-30 | | Release date: | 2006-02-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.79 Å) | | Cite: | A Versatile Conformational Switch Regulates Reactivity in Human Branched-Chain Alpha-Ketoacid Dehydrogenase.
Structure, 14, 2006
|
|
2C41
 | | X-ray structure of Dps from Thermosynechococcus elongatus | | Descriptor: | CHLORIDE ION, DPS FAMILY DNA-BINDING STRESS RESPONSE PROTEIN, TETRAETHYLENE GLYCOL, ... | | Authors: | Ilari, A, Franceschini, S, Ceci, P, Chiancone, E. | | Deposit date: | 2005-10-14 | | Release date: | 2006-10-11 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.81 Å) | | Cite: | Antioxidant Dps Protein from the Thermophilic Cyanobacterium Thermosynechococcus Elongatus.
FEBS J., 273, 2006
|
|
2BVC
 | | Crystal structure of Mycobacterium tuberculosis glutamine synthetase in complex with a transition state mimic | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, CHLORIDE ION, GLUTAMINE SYNTHETASE 1, ... | | Authors: | Krajewski, W.W, Jones, T.A, Mowbray, S.L. | | Deposit date: | 2005-06-23 | | Release date: | 2005-07-07 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structure of Mycobacterium Tuberculosis Glutamine Synthetase in Complex with a Transition-State Mimic Provides Functional Insights.
Proc.Natl.Acad.Sci.USA, 102, 2005
|
|
1S67
 | | Crystal structure of heme domain of direct oxygen sensor from E. coli | | Descriptor: | Hypothetical protein yddU, OXYGEN MOLECULE, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Park, H.J, Suquet, C, Satterlee, J.D, Kang, C.H. | | Deposit date: | 2004-01-22 | | Release date: | 2004-06-22 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Insights into signal transduction involving PAS domain oxygen-sensing heme proteins from the X-ray crystal structure of Escherichia coli Dos heme domain (Ec DosH)
Biochemistry, 43, 2004
|
|
1J05
 | | The crystal structure of anti-carcinoembryonic antigen monoclonal antibody T84.66 Fv fragment | | Descriptor: | GLYCEROL, PHOSPHATE ION, anti-CEA mAb T84.66, ... | | Authors: | Kondo, H, Nishimura, Y, Shiroishi, M, Asano, R, Noro, N, Tsumoto, K, Kumagai, I. | | Deposit date: | 2002-11-01 | | Release date: | 2003-12-16 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | The crystal structure of anti-carcinoembryonic antigen monoclonal antibody T84.66 Fv fragment
To be Published
|
|
1IZL
 | | Crystal Structure of Photosystem II | | Descriptor: | 2-[(3-HYDROXY-2-METHYL-5-PHOSPHONOOXYMETHYL-PYRIDIN-4-YLMETHYL)-AMINO]-2-METHYL-SUCCINIC ACID, BETA-CAROTENE, CHLOROPHYLL A, ... | | Authors: | Kamiya, N, Shen, J.-R. | | Deposit date: | 2002-10-04 | | Release date: | 2003-01-14 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.7 Å) | | Cite: | Crystal structure of oxygen-evolving photosystem II from Thermosynechococcus vulcanus at 3.7-A resolution
Proc.Natl.Acad.Sci.USA, 100, 2003
|
|
2BO8
 | | DISSECTION OF MANNOSYLGLYCERATE SYNTHASE: AN ARCHETYPAL MANNOSYLTRANSFERASE | | Descriptor: | CHLORIDE ION, GUANOSINE 5'-(TRIHYDROGEN DIPHOSPHATE), P'-D-MANNOPYRANOSYL ESTER, ... | | Authors: | Flint, J, Taylor, E, Yang, M, Bolam, D.N, Tailford, L.E, Martinez-Fleites, C, Dodson, E.J, Davis, B.G, Gilbert, H.J, Davies, G.J. | | Deposit date: | 2005-04-08 | | Release date: | 2005-06-06 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structural dissection and high-throughput screening of mannosylglycerate synthase.
Nat. Struct. Mol. Biol., 12, 2005
|
|
1J75
 | | Crystal Structure of the DNA-Binding Domain Zalpha of DLM-1 Bound to Z-DNA | | Descriptor: | 5'-D(*TP*CP*GP*CP*GP*CP*G)-3', Tumor Stroma and Activated Macrophage Protein DLM-1 | | Authors: | Schwartz, T, Behlke, J, Lowenhaupt, K, Heinemann, U, Rich, A. | | Deposit date: | 2001-05-15 | | Release date: | 2001-09-01 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Structure of the DLM-1-Z-DNA complex reveals a conserved family of Z-DNA-binding proteins.
Nat.Struct.Biol., 8, 2001
|
|
2BKC
 | |
2BGC
 | | PrfA-G145S, a constitutive active mutant of the Transcriptional Regulator In L.monocytogenes | | Descriptor: | (2R,3S)-1,4-DIMERCAPTOBUTANE-2,3-DIOL, 2,3-DIHYDROXY-1,4-DITHIOBUTANE, PRFA | | Authors: | Eiting, M, Hagelueken, G, Schubert, W.-D, Heinz, D.W. | | Deposit date: | 2004-12-20 | | Release date: | 2005-04-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | The Mutation G145S in Prfa, a Key Virulence Regulator of Listeria Monocytogenes, Increases DNA-Binding Affinity by Stabilizing the Hth Motif
Mol.Microbiol., 56, 2005
|
|
1INZ
 | | SOLUTION STRUCTURE OF THE EPSIN N-TERMINAL HOMOLOGY (ENTH) DOMAIN OF HUMAN EPSIN | | Descriptor: | EPS15-INTERACTING PROTEIN(EPSIN) | | Authors: | Koshiba, S, Kigawa, T, Kikuchi, A, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | | Deposit date: | 2000-12-05 | | Release date: | 2001-05-09 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the epsin N-terminal homology (ENTH) domain of human epsin
J.STRUCT.FUNCT.GENOM., 2, 2001
|
|
2BR2
 | | RNase PH core of the archaeal exosome | | Descriptor: | CHLORIDE ION, EXOSOME COMPLEX EXONUCLEASE 1, EXOSOME COMPLEX EXONUCLEASE 2 | | Authors: | lorentzen, E, Fribourg, S, Conti, E. | | Deposit date: | 2005-04-30 | | Release date: | 2005-06-06 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | The Archaeal Exosome Core is a Hexameric Ring Structure with Three Catalytic Subunits.
Nat.Struct.Mol.Biol., 12, 2005
|
|
2C38
 | | RNase PH core of the archaeal exosome in complex with A5 RNA | | Descriptor: | ADENOSINE MONOPHOSPHATE, CHLORIDE ION, PROBABLE EXOSOME COMPLEX EXONUCLEASE 1, ... | | Authors: | Lorentzen, E, Conti, E. | | Deposit date: | 2005-10-04 | | Release date: | 2005-11-23 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structural Basis of 3' End RNA Recognition and Exoribonucleolytic Cleavage by an Exosome Rnase Ph Core.
Mol.Cell, 20, 2005
|
|
2BWE
 | | The crystal structure of the complex between the UBA and UBL domains of Dsk2 | | Descriptor: | DSK2 | | Authors: | Lowe, E.D, Hasan, N, Trempe, J.-F, Fonso, L, Noble, M.E.M, Endicott, J.A, Johnson, L.N, Brown, N.R. | | Deposit date: | 2005-07-13 | | Release date: | 2006-01-25 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structures of the Dsk2 Ubl and Uba Domains and Their Complex.
Acta Crystallogr.,Sect.D, 62, 2006
|
|
1IS7
 | | Crystal structure of rat GTPCHI/GFRP stimulatory complex | | Descriptor: | GTP Cyclohydrolase I, GTP Cyclohydrolase I Feedback Regulatory Protein, PHENYLALANINE, ... | | Authors: | Maita, N, Okada, K, Hatakeyama, K, Hakoshima, T. | | Deposit date: | 2001-11-18 | | Release date: | 2002-02-20 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of the stimulatory complex of GTP cyclohydrolase I and its feedback regulatory protein GFRP.
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
