1U5S
 
 | | NMR structure of the complex between Nck-2 SH3 domain and PINCH-1 LIM4 domain | | Descriptor: | Cytoplasmic protein NCK2, PINCH protein, ZINC ION | | Authors: | Vaynberg, J, Fukuda, T, Vinogradova, O, Velyvis, A, Ng, L, Wu, C, Qin, J. | | Deposit date: | 2004-07-28 | | Release date: | 2005-04-05 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structure of an ultraweak protein-protein complex and its crucial role in regulation of cell morphology and motility.
Mol.Cell, 17, 2005
|
|
6ASF
 | |
1RQU
 | | NMR structure of L7 dimer from E.coli | | Descriptor: | 50S ribosomal protein L7/L12 | | Authors: | Bocharov, E.V, Sobol, A.G, Pavlov, K.V, Korzhnev, D.M, Jaravine, V.A, Gudkov, A.T, Arseniev, A.S. | | Deposit date: | 2003-12-07 | | Release date: | 2004-03-02 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | From structure and dynamics of protein L7/L12 to molecular switching in ribosome.
J.Biol.Chem., 279, 2004
|
|
1R2U
 | | NMR structure of the N domain of trout cardiac troponin C at 30 C | | Descriptor: | CALCIUM ION, troponin C | | Authors: | Blumenschein, T.M, Gillis, T.E, Tibbits, G.F, Sykes, B.D. | | Deposit date: | 2003-09-29 | | Release date: | 2004-06-08 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Effect of temperature on the structure of trout troponin C
Biochemistry, 43, 2004
|
|
1R6P
 | | NMR structure of the N-terminal domain of trout cardiac troponin C at 7 C | | Descriptor: | CALCIUM ION, troponin C | | Authors: | Blumenschein, T.M, Gillis, T.E, Tibbits, G.F, Sykes, B.D. | | Deposit date: | 2003-10-15 | | Release date: | 2004-06-08 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Effect of temperature on the structure of trout troponin C
Biochemistry, 43, 2004
|
|
6AST
 | | NMR and Restrained Molecular Dynamics Determination of the Structure of an Aza-Benzimidazole Derivative Complex with the DNA Minor Groove of an -AAGATA Sequence | | Descriptor: | DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3'), amino(4-{[(2-{4-[amino(iminio)methyl]phenyl}-3H-imidazo[4,5-b]pyridin-5-yl)oxy]methyl}phenyl)methaniminium | | Authors: | Harika, N.K, Germann, M.W, Wilson, W.D. | | Deposit date: | 2017-08-25 | | Release date: | 2018-01-31 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | First Structure of a Designed Minor Groove Binding Heterocyclic Cation that Specifically Recognizes Mixed DNA Base Pair Sequences.
Chemistry, 23, 2017
|
|
1U6V
 | | NMR structure of a V3 (IIIB isolate) peptide bound to 447-52D, a human HIV-1 neutralizing antibody | | Descriptor: | V3 peptide | | Authors: | Rosen, O, Chill, J, Sharon, M, Kessler, N, Mester, B, Zolla-Pazner, S, Anglister, J. | | Deposit date: | 2004-08-02 | | Release date: | 2005-04-05 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Induced fit in HIV-neutralizing antibody complexes: evidence for alternative conformations of the gp120 V3 loop and the molecular basis for broad neutralization.
Biochemistry, 44, 2005
|
|
1R7D
 | | NMR structure of the membrane anchor domain (1-31) of the nonstructural protein 5A (NS5A) of hepatitis C virus (Ensemble of 51 structures, sample in 50% tfe) | | Descriptor: | Genome polyprotein | | Authors: | Penin, F, Brass, V, Appel, N, Ramboarina, S, Montserret, R, Ficheux, D, Blum, H.E, Bartenschlager, R, Moradpour, D. | | Deposit date: | 2003-10-21 | | Release date: | 2004-08-10 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structure and function of the membrane anchor domain of hepatitis C virus nonstructural protein 5A.
J.Biol.Chem., 279, 2004
|
|
1RKL
 | |
1U6U
 | | NMR structure of a V3 (IIIB isolate) peptide bound to 447-52D, a human HIV-1 neutralizing antibody | | Descriptor: | V3 peptide | | Authors: | Rosen, O, Chill, J, Sharon, M, Kessler, N, Mester, B, Zolla-Pazner, S, Anglister, J. | | Deposit date: | 2004-08-02 | | Release date: | 2005-04-05 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Induced fit in HIV-neutralizing antibody complexes: evidence for alternative conformations of the gp120 V3 loop and the molecular basis for broad neutralization.
Biochemistry, 44, 2005
|
|
1SV1
 | |
7OB2
 | | NMR structure of the antimicrobial RiLK1 peptide in SDS micelles | | Descriptor: | RiLK1 | | Authors: | Falcigno, L, D'Auria, G, Palmieri, G, Gogliettino, M, Agrillo, B. | | Deposit date: | 2021-04-20 | | Release date: | 2021-11-17 | | Last modified: | 2024-06-19 | | Method: | SOLUTION NMR | | Cite: | Key Physicochemical Determinants in the Antimicrobial Peptide RiLK1 Promote Amphipathic Structures.
Int J Mol Sci, 22, 2021
|
|
1I8E
 | | NMR ENSEMBLE OF ION-SELECTIVE LIGAND A22 FOR PLATELET INTEGRIN ALPHAIIB-BETA3 | | Descriptor: | ION-SELECTIVE LIGAND A22 | | Authors: | Smith, J.W, Le Calvez, H, Parra-Gessert, L, Preece, N.E, Jia, X, Assa-Munt, N. | | Deposit date: | 2001-03-13 | | Release date: | 2002-07-10 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Selection and structure of ion-selective ligands for platelet integrin alpha IIb(beta) 3.
J.Biol.Chem., 277, 2002
|
|
7P27
 | | NMR solution structure of Chikungunya virus macro domain | | Descriptor: | Polyprotein P1234 | | Authors: | Lykouras, M.V, Tsika, A.C, Papageorgiou, N, Canard, B, Coutard, B, Bentrop, D, Spyroulias, G.A. | | Deposit date: | 2021-07-04 | | Release date: | 2022-07-13 | | Last modified: | 2024-06-19 | | Method: | SOLUTION NMR | | Cite: | Binding Adaptation of GS-441524 Diversifies Macro Domains and Downregulates SARS-CoV-2 de-MARylation Capacity.
J.Mol.Biol., 434, 2022
|
|
1I6Y
 | | NMR ENSEMBLE OF ION-SELECTIVE LIGAND A1 FOR PLATELET INTEGRIN ALPHAIIB-BETA3 | | Descriptor: | ION-SELECTIVE LIGAND A1 | | Authors: | Smith, J.W, Le Calvez, H, Parra-Gessert, L, Preece, N.E, Jia, X, Assa-Munt, N. | | Deposit date: | 2001-03-06 | | Release date: | 2002-07-10 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Selection and structure of ion-selective ligands for platelet integrin alpha IIb(beta) 3.
J.Biol.Chem., 277, 2002
|
|
1KQI
 | | NMR Solution Structure of the trans Pro30 Isomer of ACTX-Hi:OB4219 | | Descriptor: | ACTX-Hi:OB4219 | | Authors: | Rosengren, K.J, Wilson, D, Daly, N.L, Alewood, P.F, Craik, D.J. | | Deposit date: | 2002-01-06 | | Release date: | 2002-02-06 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Solution structures of the cis- and trans-Pro30 isomers of a novel 38-residue toxin
from the venom of Hadronyche Infensa sp. that contains a cystine-knot motif within
its four disulfide bonds
Biochemistry, 41, 2002
|
|
1KSQ
 | | NMR Study of the Third TB Domain from Latent Transforming Growth Factor-beta Binding Protein-1 | | Descriptor: | LATENT TRANSFORMING GROWTH FACTOR BETA BINDING PROTEIN 1 | | Authors: | Lack, J, O'leary, J.M, Knott, V, Yuan, X, Rifkin, D.B, Handford, P.A, Downing, A.K. | | Deposit date: | 2002-01-14 | | Release date: | 2003-08-26 | | Last modified: | 2021-11-03 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of the Third TB Domain from LTBP1 Provides Insight into Assembly
of the Large Latent Complex that Sequesters Latent TGF-beta.
J.Mol.Biol., 334, 2003
|
|
1PV3
 | | NMR Solution Structure of the Avian FAT-domain of Focal Adhesion Kinase | | Descriptor: | Focal adhesion kinase 1 | | Authors: | Prutzman, K.C, Gao, G, King, M.L, Iyer, V.V, Mueller, G.A, Schaller, M.D, Campbell, S.L. | | Deposit date: | 2003-06-26 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | The Focal Adhesion Targeting Domain of Focal Adhesion Kinase Contains a Hinge Region that Modulates Tyrosine 926 Phosphorylation.
STRUCTURE, 12, 2004
|
|
1L1W
 | | NMR structure of a SRP19 binding domain in human SRP RNA | | Descriptor: | SRP19 binding domain of SRP RNA | | Authors: | Sakamoto, T, Morita, S, Tabata, K, Nakamura, K, Kawai, G. | | Deposit date: | 2002-02-20 | | Release date: | 2002-05-22 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structure of a SRP19 binding domain in human SRP RNA.
J.Biochem.(Tokyo), 132, 2002
|
|
1LFU
 | | NMR Solution Structure of the Extended PBX Homeodomain Bound to DNA | | Descriptor: | 5'-D(*GP*CP*GP*CP*AP*TP*GP*AP*TP*TP*GP*CP*CP*C)-3', 5'-D(*GP*GP*GP*CP*AP*AP*TP*CP*AP*TP*GP*CP*GP*C)-3', homeobox protein PBX1 | | Authors: | Sprules, T, Green, N, Featherstone, M, Gehring, K. | | Deposit date: | 2002-04-12 | | Release date: | 2003-01-14 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Lock and Key Binding of the HOX YPWM Peptide to the PBX Homeodomain
J.Biol.Chem., 278, 2003
|
|
1RFR
 | | NMR structure of the 30mer stemloop-D of coxsackieviral RNA | | Descriptor: | stemloop-D RNA of the 5'-cloverleaf of coxsackievirus B3 | | Authors: | Ohlenschlager, O, Wohnert, J, Bucci, E, Seitz, S, Hafner, S, Ramachandran, R, Zell, R, Gorlach, M. | | Deposit date: | 2003-11-10 | | Release date: | 2004-03-23 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | The structure of the stemloop D subdomain of coxsackievirus B3 cloverleaf
RNA and its interaction with the proteinase 3C.
STRUCTURE, 12, 2004
|
|
1RFL
 | | NMR data driven structural model of G-domain of MnmE protein | | Descriptor: | Probable tRNA modification GTPase trmE | | Authors: | Monleon, D, Esteve, V, Martinez-Vicente, M, Yim, L, Armengod, M.E, Celda, B. | | Deposit date: | 2003-11-10 | | Release date: | 2003-12-02 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structural insights into the GTPase domain of Escherichia coli MnmE protein.
Proteins, 66, 2007
|
|
1RQS
 | | NMR structure of C-terminal domain of ribosomal protein L7 from E.coli | | Descriptor: | 50S ribosomal protein L7/L12 | | Authors: | Bocharov, E.V, Sobol, A.G, Pavlov, K.V, Korzhnev, D.M, Jaravine, V.A, Gudkov, A.T, Arseniev, A.S. | | Deposit date: | 2003-12-07 | | Release date: | 2004-03-02 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | From structure and dynamics of protein L7/L12 to molecular switching in ribosome.
J.Biol.Chem., 279, 2004
|
|
1R9I
 | | NMR Solution Structure of PIIIA toxin, NMR, 20 structures | | Descriptor: | Mu-conotoxin PIIIA | | Authors: | Nielsen, K.J, Watson, M, Adams, D.J, Hammarstrom, A.K, Gage, P.W, Hill, J.M, Craik, D.J, Thomas, L, Adams, D, Alewood, P.F, Lewis, R.J. | | Deposit date: | 2003-10-30 | | Release date: | 2003-11-18 | | Last modified: | 2019-12-25 | | Method: | SOLUTION NMR | | Cite: | Solution structure of mu-conotoxin PIIIA, a preferential inhibitor of persistent tetrodotoxin-sensitive sodium channels
J.Biol.Chem., 277, 2002
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
