7BU5
 
 | | Crystal Structure of Human SLX4 and MUS81 | | Descriptor: | GLYCINE, MUS81 endonuclease homolog (Yeast), isoform CRA_b, ... | | Authors: | Wan, B, Wu, J, Lei, M. | | Deposit date: | 2020-04-04 | | Release date: | 2021-04-07 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | SLX4 control MUS81 endonuclease function in telomere through an intermolecular SAP domain
To be published
|
|
9F9L
 | | Crystal structure of MUS81-EME1 bound by compound 16. | | Descriptor: | 2-[2-[4-(cyanomethyl)phenyl]phenyl]-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | | Authors: | Collie, G.W. | | Deposit date: | 2024-05-07 | | Release date: | 2024-07-03 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.02 Å) | | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors.
Acs Med.Chem.Lett., 15, 2024
|
|
9F98
 | | Crystal structure of MUS81-EME1, apo form. | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81 | | Authors: | Collie, G.W. | | Deposit date: | 2024-05-07 | | Release date: | 2024-07-03 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors.
Acs Med.Chem.Lett., 15, 2024
|
|
9F9M
 | | Crystal structure of MUS81-EME1 bound by compound 21. | | Descriptor: | 5-oxidanyl-4-oxidanylidene-1-(4-piperazin-1-ylphenyl)pyridine-3-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | | Authors: | Collie, G.W. | | Deposit date: | 2024-05-08 | | Release date: | 2024-06-19 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.469 Å) | | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors.
Acs Med.Chem.Lett., 15, 2024
|
|
9F9K
 | | Crystal structure of MUS81-EME1 bound by compound 15. | | Descriptor: | 5-oxidanyl-6-oxidanylidene-2-(4-phenylphenyl)-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | | Authors: | Collie, G.W. | | Deposit date: | 2024-05-07 | | Release date: | 2024-07-03 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.728 Å) | | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors.
Acs Med.Chem.Lett., 15, 2024
|
|
4P0P
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
9F99
 | | Crystal structure of MUS81-EME1 bound by compound 10. | | Descriptor: | 2-(4-chlorophenyl)-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | | Authors: | Collie, G.W. | | Deposit date: | 2024-05-07 | | Release date: | 2024-06-19 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.803 Å) | | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors.
Acs Med.Chem.Lett., 15, 2024
|
|
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
9F9A
 | | Crystal structure of MUS81-EME1 bound by compound 12. | | Descriptor: | 2-naphthalen-2-yl-5-oxidanyl-6-oxidanylidene-1H-pyrimidine-4-carboxylic acid, Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, ... | | Authors: | Collie, G.W. | | Deposit date: | 2024-05-07 | | Release date: | 2024-06-19 | | Last modified: | 2024-07-31 | | Method: | X-RAY DIFFRACTION (2.911 Å) | | Cite: | Fragment-Based Discovery of Novel MUS81 Inhibitors.
Acs Med.Chem.Lett., 15, 2024
|
|
7F6L
 | | Crystal structure of human MUS81-EME2 complex | | Descriptor: | Crossover junction endonuclease MUS81, Probable crossover junction endonuclease EME2 | | Authors: | Hua, Z.K, Zhang, D.P, Yuan, C, Lin, Z.H. | | Deposit date: | 2021-06-25 | | Release date: | 2022-03-02 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Crystal structure of the human MUS81-EME2 complex.
Structure, 30, 2022
|
|
2ZIX
 | | Crystal structure of the Mus81-Eme1 complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81 | | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | | Deposit date: | 2008-02-25 | | Release date: | 2008-04-29 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Crystal structure of the Mus81-Eme1 complex
Genes Dev., 22, 2008
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
2MC3
 | |
6VWB
 | | Solution structure of the N-terminal helix-hairpin-helix domain of human MUS81 | | Descriptor: | Crossover junction endonuclease MUS81 | | Authors: | Payliss, B, Houliston, S, Lemak, A, Arrowsmith, C.H, Wyatt, H.D.M. | | Deposit date: | 2020-02-19 | | Release date: | 2021-02-24 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Phosphorylation of the DNA repair scaffold SLX4 drives folding of the SAP domain and activation of the MUS81-EME1 endonuclease
Cell Rep, 41, 2022
|
|
