1SAL
 
 | |
1SAN
 | |
1SAP
 | |
1SAQ
 | | Crystal Structure of the RNA octamer GIC(GA)GCC | | Descriptor: | 5'-R(*GP*IP*CP*GP*AP*GP*CP*C)-3' | | Authors: | Jang, S.B, Baeyens, K, Jeong, M.S, SantaLucia Jr, J, Turner, D, Holbrook, S.R. | | Deposit date: | 2004-02-09 | | Release date: | 2004-05-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structures of two RNA octamers containing tandem G.A base pairs.
Acta Crystallogr.,Sect.D, 60, 2004
|
|
1SAR
 | |
1SAT
 | |
1SAU
 | | The Gamma subunit of the dissimilatory sulfite reductase (DsrC) from Archaeoglobus fulgidus at 1.1 A resolution | | Descriptor: | sulfite reductase, desulfoviridin-type subunit gamma | | Authors: | Mander, G.J, Weiss, M.S, Hedderich, R, Kahnt, J, Ermler, U, Warkentin, E. | | Deposit date: | 2004-02-09 | | Release date: | 2005-02-15 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (1.12 Å) | | Cite: | Determination of a novel structure by a combination of long-wavelength sulfur phasing and radiation-damage-induced phasing.
Acta Crystallogr.,Sect.D, 60, 2004
|
|
1SAV
 | | HUMAN ANNEXIN V WITH PROLINE SUBSTITUTION BY THIOPROLINE | | Descriptor: | ANNEXIN V, CALCIUM ION | | Authors: | Medrano, F.J, Minks, C, Budisa, N, Huber, R. | | Deposit date: | 1997-11-24 | | Release date: | 1998-05-27 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Crystal and molecular structure of human annexin V after refinement. Implications for structure, membrane binding and ion channel formation of the annexin family of proteins.
J.Mol.Biol., 223, 1992
|
|
1SAW
 | | X-ray structure of homo sapiens protein FLJ36880 | | Descriptor: | CHLORIDE ION, MAGNESIUM ION, hypothetical protein FLJ36880 | | Authors: | Manjasetty, B.A, Niesen, F.H, Delbrueck, H, Goetz, F, Sievert, V, Buessow, K, Behlke, J, Heinemann, U. | | Deposit date: | 2004-02-09 | | Release date: | 2004-10-12 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | X-ray structure of fumarylacetoacetate hydrolase family member Homo sapiens FLJ36880.
Biol.Chem., 385, 2004
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
1SAY
 | | L-ALANINE DEHYDROGENASE COMPLEXED WITH PYRUVATE | | Descriptor: | L-ALANINE DEHYDROGENASE, PYRUVIC ACID | | Authors: | Baker, P.J, Sawa, Y, Shibata, H, Sedelnikova, S.E, Rice, D.W. | | Deposit date: | 1998-06-05 | | Release date: | 1999-06-08 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Analysis of the structure and substrate binding of Phormidium lapideum alanine dehydrogenase.
Nat.Struct.Biol., 5, 1998
|
|
1SAZ
 | | Membership in the ASKHA Superfamily: Enzymological Properties and Crystal Structure of Butyrate Kinase 2 from Thermotoga maritima | | Descriptor: | FORMIC ACID, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, Probable butyrate kinase 2, ... | | Authors: | Diao, J, Cooper, D.R, Sanders, D.A, Hasson, M.S. | | Deposit date: | 2004-02-09 | | Release date: | 2005-03-29 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Crystal structure of butyrate kinase 2 from Thermotoga maritima, a member of the ASKHA superfamily of phosphotransferases.
J.Bacteriol., 191, 2009
|
|
1SB0
 | | Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb | | Descriptor: | protein CBP, protein c-Myb | | Authors: | Zor, T, De Guzman, R.N, Dyson, H.J, Wright, P.E. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-13 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of the KIX Domain of CBP Bound to the Transactivation
Domain of c-Myb
J.Mol.Biol., 337, 2004
|
|
1SB1
 | | Novel Non-Covalent Thrombin Inhibitors Incorporating P1 4,5,6,7-Tetrahydrobenzothiazole Arginine Side Chain Mimetics | | Descriptor: | N-(BENZYLSULFONYL)-3-CYCLOHEXYLALANYL-N-(2-AMINO-1,3-BENZOTHIAZOL-6-YL)PROLINAMIDE, Prothrombin, SODIUM ION, ... | | Authors: | Marinko, P, Krbavcic, A, Mlinsek, G, Solmajer, T, Trampus-Bakija, A, Stegnar, M, Stojan, J, Kikelj, D. | | Deposit date: | 2004-02-09 | | Release date: | 2004-06-08 | | Last modified: | 2011-11-16 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Novel non-covalent thrombin inhibitors incorporating P(1) 4,5,6,7-tetrahydrobenzothiazole arginine side chain mimetics
Eur.J.Med.Chem., 39, 2004
|
|
1SB2
 | | High resolution Structure determination of rhodocetin | | Descriptor: | Rhodocetin alpha subunit, Rhodocetin beta subunit | | Authors: | Paaventhan, P, Kong, C.G, Joseph, J.S, Chung, M.C.M, Kolatkar, P.R. | | Deposit date: | 2004-02-10 | | Release date: | 2005-02-01 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structure of rhodocetin reveals noncovalently bound heterodimer interface
Protein Sci., 14, 2005
|
|
1SB3
 | | Structure of 4-hydroxybenzoyl-CoA reductase from Thauera aromatica | | Descriptor: | (MOLYBDOPTERIN-CYTOSINE DINUCLEOTIDE-S,S)-DIOXO-AQUA-MOLYBDENUM(V), 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, 4-hydroxybenzoyl-CoA reductase alpha subunit, ... | | Authors: | Unciuleac, M, Warkentin, E, Page, C.C, Boll, M, Ermler, U. | | Deposit date: | 2004-02-10 | | Release date: | 2004-12-21 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure of a Xanthine Oxidase-Related 4-Hydroxybenzoyl-CoA Reductase with an Additional [4Fe-4S] Cluster and an Inverted Electron Flow.
Structure, 12, 2004
|
|
1SB6
 | | Solution structure of a cyanobacterial copper metallochaperone, ScAtx1 | | Descriptor: | copper chaperone ScAtx1 | | Authors: | Banci, L, Bertini, I, Ciofi-Baffoni, S, Su, X.C, Borrelly, G.P, Robinson, N.J, Structural Proteomics in Europe (SPINE) | | Deposit date: | 2004-02-10 | | Release date: | 2004-04-27 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Structures of a Cyanobacterial Metallochaperone: INSIGHT INTO AN ATYPICAL COPPER-BINDING MOTIF.
J.Biol.Chem., 279, 2004
|
|
1SB7
 | |
1SB8
 | | Crystal structure of Pseudomonas aeruginosa UDP-N-acetylglucosamine 4-epimerase complexed with UDP-N-acetylgalactosamine | | Descriptor: | NICOTINAMIDE-ADENINE-DINUCLEOTIDE, URIDINE-DIPHOSPHATE-N-ACETYLGALACTOSAMINE, wbpP | | Authors: | Ishiyama, N, Creuzenet, C, Lam, J.S, Berghuis, A.M. | | Deposit date: | 2004-02-10 | | Release date: | 2004-05-25 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal Structure of WbpP, a Genuine UDP-N-acetylglucosamine 4-Epimerase from Pseudomonas aeruginosa: SUBSTRATE SPECIFICITY IN UDP-HEXOSE 4-EPIMERASES.
J.Biol.Chem., 279, 2004
|
|
1SB9
 | | Crystal structure of Pseudomonas aeruginosa UDP-N-acetylglucosamine 4-epimerase complexed with UDP-glucose | | Descriptor: | NICOTINAMIDE-ADENINE-DINUCLEOTIDE, URIDINE-5'-DIPHOSPHATE-GLUCOSE, wbpP | | Authors: | Ishiyama, N, Creuzenet, C, Lam, J.S, Berghuis, A.M. | | Deposit date: | 2004-02-10 | | Release date: | 2004-05-25 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Crystal Structure of WbpP, a Genuine UDP-N-acetylglucosamine 4-Epimerase from Pseudomonas aeruginosa: SUBSTRATE SPECIFICITY IN UDP-HEXOSE 4-EPIMERASES.
J.Biol.Chem., 279, 2004
|
|
1SBB
 | | T-CELL RECEPTOR BETA CHAIN COMPLEXED WITH SUPERANTIGEN SEB | | Descriptor: | PROTEIN (14.3.D T CELL ANTIGEN RECEPTOR), PROTEIN (STAPHYLOCOCCAL ENTEROTOXIN B) | | Authors: | Li, H, Mariuzza, R.A. | | Deposit date: | 1999-02-22 | | Release date: | 1999-03-01 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Three-dimensional structure of the complex between a T cell receptor beta chain and the superantigen staphylococcal enterotoxin B.
Immunity, 9, 1998
|
|
1SBC
 | |
1SBD
 | | SOYBEAN AGGLUTININ COMPLEXED WITH 2,4-PENTASACCHARIDE | | Descriptor: | CALCIUM ION, MANGANESE (II) ION, SOYBEAN AGGLUTININ, ... | | Authors: | Dessen, A, Olsen, L.R, Gupta, D, Sabesan, S, Brewer, C.F, Sacchettini, J.C. | | Deposit date: | 1995-07-13 | | Release date: | 1998-04-22 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.52 Å) | | Cite: | X-ray crystallographic studies of unique cross-linked lattices between four isomeric biantennary oligosaccharides and soybean agglutinin.
Biochemistry, 36, 1997
|
|
1SBE
 | | SOYBEAN AGGLUTININ FROM GLYCINE MAX | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CALCIUM ION, MANGANESE (II) ION, ... | | Authors: | Dessen, A, Olsen, L.R, Gupta, D, Sabesan, S, Sacchettini, J.C, Brewer, C.F. | | Deposit date: | 1995-07-13 | | Release date: | 1998-04-22 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | X-ray crystallographic studies of unique cross-linked lattices between four isomeric biantennary oligosaccharides and soybean agglutinin.
Biochemistry, 36, 1997
|
|
1SBF
 | | SOYBEAN AGGLUTININ | | Descriptor: | CALCIUM ION, MANGANESE (II) ION, SOYBEAN AGGLUTININ, ... | | Authors: | Olsen, L.R, Dessen, A, Gupta, D, Sabesan, S, Brewer, C.F, Sacchettini, J.C. | | Deposit date: | 1997-10-21 | | Release date: | 1998-04-22 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.43 Å) | | Cite: | X-ray crystallographic studies of unique cross-linked lattices between four isomeric biantennary oligosaccharides and soybean agglutinin.
Biochemistry, 36, 1997
|
|
