1I94
 
 | | CRYSTAL STRUCTURES OF THE SMALL RIBOSOMAL SUBUNIT WITH TETRACYCLINE, EDEINE AND IF3 | | Descriptor: | 16S RRNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | | Authors: | Pioletti, M, Schluenzen, F, Harms, J, Zarivach, R, Gluehmann, M, Avila, H, Bartels, H, Jacobi, C, Hartsch, T, Yonath, A, Franceschi, F. | | Deposit date: | 2001-03-18 | | Release date: | 2001-04-12 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Crystal structures of complexes of the small ribosomal subunit with tetracycline, edeine and IF3.
EMBO J., 20, 2001
|
|
7WBV
 | | RNA polymerase II elongation complex bound with Elf1 and Spt4/5, stalled at SHL(-4) of the nucleosome | | Descriptor: | DNA (159-MER), DNA (198-MER), DNA-directed RNA polymerase subunit, ... | | Authors: | Osumi, K, Kujirai, T, Ehara, H, Sekine, S, Takizawa, Y, Kurumizaka, H. | | Deposit date: | 2021-12-17 | | Release date: | 2023-07-05 | | Last modified: | 2024-06-26 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structural Basis of Damaged Nucleotide Recognition by Transcribing RNA Polymerase II in the Nucleosome.
J.Mol.Biol., 435, 2023
|
|
7WBW
 | | RNA polymerase II elongation complex bound with Elf1 and Spt4/5, stalled at SHL(-3.5) of the nucleosome | | Descriptor: | DNA (198-MER), DNA-directed RNA polymerase subunit, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Osumi, K, Kujirai, T, Ehara, H, Sekine, S, Takizawa, Y, Kurumizaka, H. | | Deposit date: | 2021-12-17 | | Release date: | 2023-07-05 | | Last modified: | 2024-06-26 | | Method: | ELECTRON MICROSCOPY (7.1 Å) | | Cite: | Structural Basis of Damaged Nucleotide Recognition by Transcribing RNA Polymerase II in the Nucleosome.
J.Mol.Biol., 435, 2023
|
|
7WBX
 | | RNA polymerase II elongation complex bound with Elf1 and Spt4/5, stalled at SHL(-3) of the nucleosome | | Descriptor: | DNA (198-MER), DNA-directed RNA polymerase subunit, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Osumi, K, Kujirai, T, Ehara, H, Sekine, S, Takizawa, Y, Kurumizaka, H. | | Deposit date: | 2021-12-17 | | Release date: | 2023-07-05 | | Last modified: | 2024-06-26 | | Method: | ELECTRON MICROSCOPY (4 Å) | | Cite: | Structural Basis of Damaged Nucleotide Recognition by Transcribing RNA Polymerase II in the Nucleosome.
J.Mol.Biol., 435, 2023
|
|
5V7Q
 | | Cryo-EM structure of the large ribosomal subunit from Mycobacterium tuberculosis bound with a potent linezolid analog | | Descriptor: | 23S rRNA, 50S ribosomal protein L13, 50S ribosomal protein L14, ... | | Authors: | Yang, K, Chang, J.-Y, Cui, Z, Zhang, J. | | Deposit date: | 2017-03-20 | | Release date: | 2017-09-20 | | Last modified: | 2024-03-13 | | Method: | ELECTRON MICROSCOPY (3.7 Å) | | Cite: | Structural insights into species-specific features of the ribosome from the human pathogen Mycobacterium tuberculosis.
Nucleic Acids Res., 45, 2017
|
|
5UZ4
 | | The cryo-EM structure of YjeQ bound to the 30S subunit suggests a fidelity checkpoint function for this protein in ribosome assembly | | Descriptor: | 16S RIBOSOMAL RNA, 3'-O-(N-methylanthraniloyl)-beta:gamma-imidoguanosine-5'-triphosphate, 30S ribosomal protein S10, ... | | Authors: | Razi, A, Guarne, A, Ortega, J. | | Deposit date: | 2017-02-24 | | Release date: | 2017-04-19 | | Last modified: | 2020-01-15 | | Method: | ELECTRON MICROSCOPY (5.8 Å) | | Cite: | The cryo-EM structure of YjeQ bound to the 30S subunit suggests a fidelity checkpoint function for this protein in ribosome assembly.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
6EXV
 | | Structure of mammalian RNA polymerase II elongation complex inhibited by Alpha-amanitin | | Descriptor: | AMATOXIN, DNA (25-MER), DNA (36-MER), ... | | Authors: | Liu, X, Farnung, L, Wigge, C, Cramer, P. | | Deposit date: | 2017-11-09 | | Release date: | 2018-03-21 | | Last modified: | 2019-12-11 | | Method: | ELECTRON MICROSCOPY (3.6 Å) | | Cite: | Cryo-EM structure of a mammalian RNA polymerase II elongation complex inhibited by alpha-amanitin.
J. Biol. Chem., 293, 2018
|
|
6F41
 | | RNA Polymerase III initially transcribing complex | | Descriptor: | DNA-directed RNA polymerase III subunit RPC1, DNA-directed RNA polymerase III subunit RPC10, DNA-directed RNA polymerase III subunit RPC2, ... | | Authors: | Vorlaender, M.K, Khatter, H, Wetzel, R, Hagen, W.J.H, Mueller, C.W. | | Deposit date: | 2017-11-29 | | Release date: | 2018-01-17 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (4.3 Å) | | Cite: | Molecular mechanism of promoter opening by RNA polymerase III.
Nature, 553, 2018
|
|
1KOJ
 | | Crystal structure of rabbit phosphoglucose isomerase complexed with 5-phospho-D-arabinonohydroxamic acid | | Descriptor: | 5-PHOSPHO-D-ARABINOHYDROXAMIC ACID, Glucose-6-phosphate isomerase | | Authors: | Arsenieva, D, Hardre, R, Salmon, L, Jeffery, C.J. | | Deposit date: | 2001-12-20 | | Release date: | 2002-05-03 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | The crystal structure of rabbit phosphoglucose isomerase complexed with 5-phospho-D-arabinonohydroxamic acid.
Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
7EGP
 | | The structure of SWI/SNF-nucleosome complex | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Actin-like protein ARP9, Actin-related protein 7, ... | | Authors: | Chen, Z.C, Chen, K.J, He, Z.Y, Ye, Y.P. | | Deposit date: | 2021-03-24 | | Release date: | 2022-01-12 | | Method: | ELECTRON MICROSCOPY (6.9 Å) | | Cite: | Structure of the SWI/SNF complex bound to the nucleosome and insights into the functional modularity.
Cell Discov, 7, 2021
|
|
6FF7
 | | human Bact spliceosome core structure | | Descriptor: | 116 kDa U5 small nuclear ribonucleoprotein component, ADENOSINE-5'-DIPHOSPHATE, BUD13 homolog, ... | | Authors: | Haselbach, D, Komarov, I, Agafonov, D, Hartmuth, K, Graf, B, Kastner, B, Luehrmann, R, Stark, H. | | Deposit date: | 2018-01-03 | | Release date: | 2019-03-13 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | Structure and Conformational Dynamics of the Human Spliceosomal BactComplex.
Cell, 172, 2018
|
|
6EU1
 | | RNA Polymerase III - open DNA complex (OC-POL3). | | Descriptor: | DNA-directed RNA polymerase III subunit RPC1, DNA-directed RNA polymerase III subunit RPC10, DNA-directed RNA polymerase III subunit RPC2, ... | | Authors: | Abascal-Palacios, G, Ramsay, E.P, Beuron, F, Morris, E, Vannini, A. | | Deposit date: | 2017-10-27 | | Release date: | 2018-01-17 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Structural basis of RNA polymerase III transcription initiation.
Nature, 553, 2018
|
|
6F40
 | | RNA Polymerase III open complex | | Descriptor: | DNA-directed RNA polymerase III subunit RPC1, DNA-directed RNA polymerase III subunit RPC10, DNA-directed RNA polymerase III subunit RPC2, ... | | Authors: | Vorlaender, M.K, Khatter, H, Wetzel, R, Hagen, W.J.H, Mueller, C.W. | | Deposit date: | 2017-11-29 | | Release date: | 2018-01-17 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.7 Å) | | Cite: | Molecular mechanism of promoter opening by RNA polymerase III.
Nature, 553, 2018
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
5TBW
 | | Crystal structure of chlorolissoclimide bound to the yeast 80S ribosome | | Descriptor: | 18S ribosomal RNA, 25S ribosomal RNA, 40S ribosomal protein S0-A, ... | | Authors: | Konst, Z.A, Szklarski, A.R, Pellegrino, S, Michalak, S.E, Meyer, M, Zanette, C, Cencic, R, Nam, S, Horne, D.A, Pelletier, J, Mobley, D.L, Yusupova, G, Yusupov, M, Vanderwal, C.D. | | Deposit date: | 2016-09-13 | | Release date: | 2017-07-26 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Synthesis facilitates an understanding of the structural basis for translation inhibition by the lissoclimides.
Nat Chem, 9, 2017
|
|
1HR0
 | | CRYSTAL STRUCTURE OF INITIATION FACTOR IF1 BOUND TO THE 30S RIBOSOMAL SUBUNIT | | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | | Authors: | Carter, A.P, Clemons Jr, W.M, Brodersen, D.E, Morgan-Warren, R.J, Wimberly, B.T, Ramakrishnan, V. | | Deposit date: | 2000-12-20 | | Release date: | 2001-01-24 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Crystal structure of an initiation factor bound to the 30S ribosomal subunit.
Science, 291, 2001
|
|
5XH7
 | | Crystal structure of the Acidaminococcus sp. BV3L6 Cpf1 RR variant in complex with crRNA and target DNA (TCCA PAM) | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, CRISPR-associated endonuclease Cpf1, ... | | Authors: | Nishimasu, H, Yamano, T, Ishitani, R, Nureki, O. | | Deposit date: | 2017-04-19 | | Release date: | 2017-06-14 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural Basis for the Altered PAM Recognition by Engineered CRISPR-Cpf1
Mol. Cell, 67, 2017
|
|
5XTH
 | | Cryo-EM structure of human respiratory supercomplex I1III2IV1 | | Descriptor: | (9R,11S)-9-({[(1S)-1-HYDROXYHEXADECYL]OXY}METHYL)-2,2-DIMETHYL-5,7,10-TRIOXA-2LAMBDA~5~-AZA-6LAMBDA~5~-PHOSPHAOCTACOSANE-6,6,11-TRIOL, 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine, Acyl carrier protein, ... | | Authors: | Gu, J, Wu, M, Yang, M. | | Deposit date: | 2017-06-19 | | Release date: | 2017-09-13 | | Last modified: | 2019-11-20 | | Method: | ELECTRON MICROSCOPY (3.9 Å) | | Cite: | Architecture of Human Mitochondrial Respiratory Megacomplex I2III2IV2.
Cell, 170, 2017
|
|
1HM5
 | |
1HTY
 | | GOLGI ALPHA-MANNOSIDASE II | | Descriptor: | (4R)-2-METHYLPENTANE-2,4-DIOL, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | van den Elsen, J.M.H, Kuntz, D.A, Rose, D.R. | | Deposit date: | 2001-01-02 | | Release date: | 2002-01-02 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structure of Golgi alpha-mannosidase II: a target for inhibition of growth and metastasis of cancer cells.
EMBO J., 20, 2001
|
|
1J5E
 | | Structure of the Thermus thermophilus 30S Ribosomal Subunit | | Descriptor: | 16S ribosomal RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | | Authors: | Wimberly, B.T, Brodersen, D.E, Clemons Jr, W.M, Morgan-Warren, R, Carter, A.P, Vonrhein, C, Hartsch, T, Ramakrishnan, V. | | Deposit date: | 2002-04-08 | | Release date: | 2002-04-12 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (3.05 Å) | | Cite: | Structure of the 30S ribosomal subunit.
Nature, 407, 2000
|
|
1L1E
 | | Crystal Structure of Mycolic Acid Cyclopropane Synthase PcaA Complexed with S-adenosyl-L-homocysteine | | Descriptor: | CARBONATE ION, S-ADENOSYL-L-HOMOCYSTEINE, mycolic acid synthase | | Authors: | Huang, C.-C, Smith, C.V, Glickman, M.S, Jacobs Jr, W.R, Sacchettini, J.C, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2002-02-15 | | Release date: | 2002-03-06 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal structures of mycolic acid cyclopropane synthases from Mycobacterium tuberculosis.
J.Biol.Chem., 277, 2002
|
|
1VWK
 | | STREPTAVIDIN-CYCLO-[5-S-VALERAMIDE-HPQGPPC]K-NH2 | | Descriptor: | PENTANOIC ACID, PEPTIDE LIGAND CONTAINING HPQ, STREPTAVIDIN | | Authors: | Katz, B.A, Cass, R.T. | | Deposit date: | 1997-03-03 | | Release date: | 1998-03-18 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | In crystals of complexes of streptavidin with peptide ligands containing the HPQ sequence the pKa of the peptide histidine is less than 3.0.
J.Biol.Chem., 272, 1997
|
|
8CBN
 | | structure of LEDGF/p75 PWWP domain bound to the H3K36 trimethylated dinucleosome | | Descriptor: | Histone H2A, Histone H2B 1.1, Histone H3, ... | | Authors: | Koutna, E, Kouba, T, Novacek, J, Veverka, V. | | Deposit date: | 2023-01-25 | | Release date: | 2023-12-27 | | Method: | ELECTRON MICROSCOPY (3.34 Å) | | Cite: | Multivalency of nucleosome recognition by LEDGF.
Nucleic Acids Res., 51, 2023
|
|
