1QAW
 
 | | Regulatory Features of the TRP Operon and the Crystal Structure of the TRP RNA-Binding Attenuation Protein from Bacillus Stearothermophilus. | | Descriptor: | TRP RNA-BINDING ATTENUATION PROTEIN, TRYPTOPHAN | | Authors: | Chen, X.-P, Antson, A.A, Yang, M, Baumann, C, Dodson, E.J, Dodson, G.G, Gollnick, P. | | Deposit date: | 1999-03-31 | | Release date: | 1999-04-16 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Regulatory features of the trp operon and the crystal structure of the trp RNA-binding attenuation protein from Bacillus stearothermophilus.
J.Mol.Biol., 289, 1999
|
|
1OYH
 | | Crystal Structure of P13 Alanine Variant of Antithrombin | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Antithrombin-III, ... | | Authors: | Johnson, D.J.D, Huntington, J.A. | | Deposit date: | 2003-04-04 | | Release date: | 2004-04-13 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.62 Å) | | Cite: | The influence of hinge region residue Glu-381 on antithrombin allostery and metastability
J.Biol.Chem., 279, 2004
|
|
1OQ0
 | |
1OVM
 | | Crystal structure of Indolepyruvate decarboxylase from Enterobacter cloacae | | Descriptor: | Indole-3-pyruvate decarboxylase, MAGNESIUM ION, THIAMINE DIPHOSPHATE | | Authors: | Schutz, A, Sandalova, T, Ricagno, S, Hubner, G, Konig, S, Schneider, G. | | Deposit date: | 2003-03-27 | | Release date: | 2003-06-03 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid
Eur.J.Biochem., 270, 2003
|
|
1OLP
 | | Alpha Toxin from Clostridium Absonum | | Descriptor: | ALPHA-TOXIN, CALCIUM ION, ZINC ION | | Authors: | Briggs, D.C, Basak, A.K. | | Deposit date: | 2003-08-11 | | Release date: | 2003-10-23 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Clostridium Absonum Alpha-Toxin: New Insights Into Clostridial Phospholipase C Substrate Binding and Specificity
J.Mol.Biol., 333, 2003
|
|
1OK4
 | | Archaeal fructose 1,6-bisphosphate aldolase covalently bound to the substrate dihydroxyacetone phosphate | | Descriptor: | 1,3-DIHYDROXYACETONEPHOSPHATE, FRUCTOSE-BISPHOSPHATE ALDOLASE CLASS I | | Authors: | Lorentzen, E, Zwart, P, Stark, A, Hensel, R, Siebers, B, Pohl, E. | | Deposit date: | 2003-07-17 | | Release date: | 2003-09-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure of an archaeal class I aldolase and the evolution of (betaalpha)8 barrel proteins.
J. Biol. Chem., 278, 2003
|
|
1OK6
 | | Orthorhombic crystal form of an Archaeal fructose 1,6-bisphosphate aldolase | | Descriptor: | FRUCTOSE-BISPHOSPHATE ALDOLASE CLASS I, GLYCEROL | | Authors: | Lorentzen, E, Zwart, P, Stark, A, Hensel, R, Siebers, B, Pohl, E. | | Deposit date: | 2003-07-18 | | Release date: | 2003-09-04 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Crystal structure of an archaeal class I aldolase and the evolution of (betaalpha)8 barrel proteins.
J. Biol. Chem., 278, 2003
|
|
1QJ9
 | |
1Q8O
 | | Pterocartpus angolensis lectin PAL in complex with the dimmanoside Man(alpha1-2)Man | | Descriptor: | CALCIUM ION, MANGANESE (II) ION, alpha-D-mannopyranose-(1-2)-methyl alpha-D-mannopyranoside, ... | | Authors: | Loris, R, Van Walle, I, De Greve, H, Beeckmans, S, Deboeck, F, Wyns, L, Bouckaert, J. | | Deposit date: | 2003-08-22 | | Release date: | 2004-02-10 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structural Basis of Oligomannose Recognition by the Pterocarpus angolensis Seed Lectin
J.Mol.Biol., 335, 2004
|
|
1QVV
 | | Crystal structure of the S. cerevisiae YDR533c protein | | Descriptor: | YDR533c protein | | Authors: | Graille, M, Leulliot, N, Quevillon-Cheruel, S, van Tilbeurgh, H. | | Deposit date: | 2003-08-29 | | Release date: | 2004-03-30 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Crystal structure of the YDR533c S. cerevisiae protein, a class II member of the Hsp31 family
STRUCTURE, 12, 2004
|
|
1Q8S
 | | Pterocarpus angolensis lectin (PAL) in complex with the dimannoside Man(alpha1-6)Man | | Descriptor: | CALCIUM ION, MANGANESE (II) ION, alpha-D-mannopyranose-(1-6)-methyl alpha-D-mannopyranoside, ... | | Authors: | Loris, R, Van Walle, I, De Greve, H, Beeckmans, S, DeBoeck, F, Wyns, L, Bouckaert, J. | | Deposit date: | 2003-08-22 | | Release date: | 2004-02-10 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Structural Basis of Oligomannose Recognition by the Pterocarpus angolensis Seed Lectin
J.Mol.Biol., 335, 2004
|
|
1QJ5
 | | Crystal structure of 7,8-diaminopelargonic acid synthase | | Descriptor: | 7,8-DIAMINOPELARGONIC ACID SYNTHASE, POTASSIUM ION, PYRIDOXAL-5'-PHOSPHATE | | Authors: | Kack, H, Sandmark, J, Gibson, K.J, Lindqvist, Y, Schneider, G. | | Deposit date: | 1999-06-21 | | Release date: | 2000-06-22 | | Last modified: | 2019-07-24 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal Structure of Diaminopelargonic Acid Synthase; Evolutionary Relationships between Pyridoxal-5'-Phosphate Dependent Enzymes
J.Mol.Biol., 291, 1999
|
|
1QOQ
 | |
1QNL
 | |
1R7H
 | |
1PUZ
 | | Solution NMR Structure of Protein NMA1147 from Neisseria meningitidis. Northeast Structural Genomics Consortium Target MR19 | | Descriptor: | conserved hypothetical protein | | Authors: | Liu, G, Xu, D, Sukumaran, D.K, Chiang, Y, Acton, T, Montelione, G.T, Szyperski, T, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2003-06-25 | | Release date: | 2004-06-29 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | NMR structure of the hypothetical protein NMA1147 from Neisseria meningitidis reveals a distinct 5-helix bundle.
Proteins, 55, 2004
|
|
1PMH
 | | Crystal structure of Caldicellulosiruptor saccharolyticus CBM27-1 in complex with mannohexaose | | Descriptor: | 1,2-ETHANEDIOL, CALCIUM ION, beta-1,4-mannanase, ... | | Authors: | Roske, Y, Sunna, A, Heinemann, U. | | Deposit date: | 2003-06-11 | | Release date: | 2004-06-22 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.06 Å) | | Cite: | High-resolution crystal structures of Caldicellulosiruptor strain Rt8B.4 carbohydrate-binding module CBM27-1 and its complex with mannohexaose.
J.Mol.Biol., 340, 2004
|
|
1PE1
 | | Aquifex aeolicus KDO8PS in complex with cadmium and 2-PGA | | Descriptor: | 2-PHOSPHOGLYCERIC ACID, 2-dehydro-3-deoxyphosphooctonate aldolase, CADMIUM ION, ... | | Authors: | Wang, J, Xu, X, Grison, C, Petek, S, Coutrot, P, Birck, M.R, Woodard, R.W, Gatti, D.L. | | Deposit date: | 2003-05-20 | | Release date: | 2004-02-03 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.74 Å) | | Cite: | Structure-Based Design of Novel Inhibitors of 3-Deoxy-D-manno-octulosonate 8-Phosphate Synthase
DRUG DES.DISCOVERY, 18, 2003
|
|
1PAR
 | | DNA RECOGNITION BY BETA-SHEETS IN THE ARC REPRESSOR-OPERATOR CRYSTAL STRUCTURE | | Descriptor: | DNA (5'-D(*AP*AP*TP*GP*AP*TP*AP*GP*AP*AP*GP*CP*AP*CP*TP*CP*T P*AP*CP*TP*AP*T)- 3'), DNA (5'-D(*TP*AP*TP*AP*GP*TP*AP*GP*AP*GP*TP*GP*CP*TP*TP*CP*T P*AP*TP*CP*AP*T)- 3'), PROTEIN (ARC REPRESSOR) | | Authors: | Raumann, B.E, Rould, M.A, Pabo, C.O, Sauer, R.T. | | Deposit date: | 1994-03-22 | | Release date: | 1994-07-31 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | DNA recognition by beta-sheets in the Arc repressor-operator crystal structure.
Nature, 367, 1994
|
|
1PG6
 | | X-Ray Crystal Structure of Protein SPYM3_0169 from Streptococcus pyogenes. Northeast Structural Genomics Consortium Target DR2. | | Descriptor: | CALCIUM ION, Hypothetical protein SpyM3_0169 | | Authors: | Kuzin, A, Lee, I, Edstrom, W, Xiao, R, Acton, T, Rost, B, Montelione, G, Hunt, J, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2003-05-27 | | Release date: | 2003-12-02 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | X-ray structure of hypothetical protein SPYM3_0169 from Streptococcus pyogenes
To be Published, 2003
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1RF6
 | | Structural Studies of Streptococcus pneumoniae EPSP Synthase in S3P-GLP Bound State | | Descriptor: | 5-enolpyruvylshikimate-3-phosphate synthase, GLYPHOSATE, SHIKIMATE-3-PHOSPHATE | | Authors: | Park, H, Hilsenbeck, J.L, Kim, H.J, Shuttleworth, W.A, Park, Y.H, Evans, J.N, Kang, C. | | Deposit date: | 2003-11-07 | | Release date: | 2004-02-17 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structural studies of Streptococcus pneumoniae EPSP synthase in unliganded state, tetrahedral intermediate-bound state and S3P-GLP-bound state.
Mol.Microbiol., 51, 2004
|
|
1RMT
 | | Crystal structure of AphA class B acid phosphatase/phosphotransferase complexed with adenosine. | | Descriptor: | ADENOSINE, Class B acid phosphatase, MAGNESIUM ION | | Authors: | Calderone, V, Forleo, C, Benvenuti, M, Rossolini, G.M, Thaller, M.C, Mangani, S. | | Deposit date: | 2003-11-28 | | Release date: | 2004-12-14 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Insights in the catalytic mechanism of AphA from Escherichia coli
To be Published
|
|
1R6A
 | | Structure of the dengue virus 2'O methyltransferase in complex with s-adenosyl homocysteine and ribavirin 5' triphosphate | | Descriptor: | Genome polyprotein, RIBAVIRIN MONOPHOSPHATE, S-ADENOSYL-L-HOMOCYSTEINE, ... | | Authors: | Benarroch, D, Egloff, M.P, Mulard, L, Romette, J.L, Canard, B. | | Deposit date: | 2003-10-15 | | Release date: | 2004-09-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | A structural basis for the inhibition of the NS5 dengue virus mRNA 2'-O-methyltransferase domain by ribavirin 5'-triphosphate.
J.Biol.Chem., 279, 2004
|
|
1RF4
 | | Structural Studies of Streptococcus pneumoniae EPSP Synthase, Tetrahedral intermediate Bound State | | Descriptor: | (3R,4S,5R)-5-{[(1R)-1-CARBOXY-2-FLUORO-1-(PHOSPHONOOXY)ETHYL]OXY}-4-HYDROXY-3-(PHOSPHONOOXY)CYCLOHEX-1-ENE-1-CARBOXYLIC ACID, 5-enolpyruvylshikimate-3-phosphate synthase | | Authors: | Park, H, Hilsenbeck, J.L, Kim, H.J, Shuttleworth, W.A, Park, Y.H, Evans, J.N, Kang, C. | | Deposit date: | 2003-11-07 | | Release date: | 2004-02-17 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structural studies of Streptococcus pneumoniae EPSP synthase in unliganded state, tetrahedral intermediate-bound state and S3P-GLP-bound state.
Mol.Microbiol., 51, 2004
|
|
