3X2L
 
 | | X-ray structure of PcCel45A apo form at 95K. | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 3-methylpentane-1,5-diol, Endoglucanase V-like protein | | Authors: | Nakamura, A, Ishida, T, Ohta, K, Tanaka, H, Inaka, K, Samejima, M, Igarashi, K. | | Deposit date: | 2014-12-22 | | Release date: | 2015-10-14 | | Last modified: | 2019-12-18 | | Method: | X-RAY DIFFRACTION (0.83 Å) | | Cite: | "Newton's cradle" proton relay with amide-imidic acid tautomerization in inverting cellulase visualized by neutron crystallography.
Sci Adv, 1, 2015
|
|
3X2N
 | | Proton relay pathway in inverting cellulase | | Descriptor: | Endoglucanase V-like protein, SULFATE ION | | Authors: | Nakamura, A, Ishida, T, Fushinobu, S, Igarashi, K, Samejima, M. | | Deposit date: | 2014-12-22 | | Release date: | 2015-10-14 | | Last modified: | 2019-12-18 | | Method: | X-RAY DIFFRACTION (1.2 Å) | | Cite: | "Newton's cradle" proton relay with amide-imidic acid tautomerization in inverting cellulase visualized by neutron crystallography.
Sci Adv, 1, 2015
|
|
3ZTJ
 | | Structure of influenza A neutralizing antibody selected from cultures of single human plasma cells in complex with human H3 Influenza haemagglutinin. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, FI6V3 ANTIBODY HEAVY CHAIN, ... | | Authors: | Voss, J.E, Vachieri, S.G, Gamblin, S.J, Collins, P.J, Haire, L.F, Skehel, J.J. | | Deposit date: | 2011-07-08 | | Release date: | 2011-08-10 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (3.41 Å) | | Cite: | A Neutralizing Antibody Selected from Plasma Cells that Binds to Group 1 and Group 2 Influenza a Hemagglutinins.
Science, 333, 2011
|
|
3ZTN
 | | STRUCTURE OF INFLUENZA A NEUTRALIZING ANTIBODY SELECTED FROM CULTURES OF SINGLE HUMAN PLASMA CELLS IN COMPLEX WITH HUMAN H1 INFLUENZA HAEMAGGLUTININ. | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, FI6V3 ANTIBODY LIGHT CHAIN, ... | | Authors: | Hubbard, P.A, Ritchie, A.J, Corti, D, Voss, J.E, Gamblin, S.J, Codoni, G, Macagno, A, Jarrossay, D, Pinna, D, Minola, A, Vanzetta, F, Silacci, C, Fernandez-Rodriguez, B.M, Agatic, G, Giacchetto-Sasselli, I, Vachieri, S.G, Sallusto, F, Collins, P.J, Haire, L.F, Temperton, N, Langedijk, J.P.M, Skehel, J.J, Lanzavecchia, A. | | Deposit date: | 2011-07-12 | | Release date: | 2011-08-10 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (3.001 Å) | | Cite: | A Neutralizing Antibody Selected from Plasma Cells that Binds to Group 1 and Group 2 Influenza a Hemagglutinins.
Science, 333, 2011
|
|
3ZWU
 | | Pseudomonas fluorescens PhoX in complex with vanadate, a transition state analogue | | Descriptor: | ALKALINE PHOSPHATASE PHOX, CALCIUM ION, CHLORIDE ION, ... | | Authors: | Yong, S.C, Roversi, P, Lillington, J.E.D, Zeldin, O.B, Garman, E.F, Lea, S.M, Berks, B.C. | | Deposit date: | 2011-08-02 | | Release date: | 2012-08-08 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.39 Å) | | Cite: | A Complex Iron-Calcium Cofactor Catalyzing Phosphotransfer Chemistry
Science, 345, 2014
|
|
3ZFW
 | | Crystal structure of the TPR domain of kinesin light chain 2 in complex with a tryptophan-acidic cargo peptide | | Descriptor: | KINESIN LIGHT CHAIN 2, PLECKSTRIN HOMOLOGY DOMAIN-CONTAINING FAMILY M MEMBER 2 | | Authors: | Pernigo, S, Lamprecht, A, Steiner, R.A, Dodding, M.P. | | Deposit date: | 2012-12-12 | | Release date: | 2013-04-03 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structural Basis for Kinesin-1:Cargo Recognition.
Science, 340, 2013
|
|
6FHK
 | |
1LDA
 | | CRYSTAL STRUCTURE OF THE E. COLI GLYCEROL FACILITATOR (GLPF) WITHOUT SUBSTRATE GLYCEROL | | Descriptor: | Glycerol uptake facilitator protein, octyl beta-D-glucopyranoside | | Authors: | Nollert, P, Miercke, L.J.W, O'Connell, J, Stroud, R.M. | | Deposit date: | 2002-04-08 | | Release date: | 2002-05-08 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Control of the selectivity of the aquaporin water channel family by global orientational tuning.
Science, 296, 2002
|
|
1LDI
 | | CRYSTAL STRUCTURE OF THE E. COLI GLYCEROL FACILITATOR (GLPF) WITHOUT SUBSTRATE GLYCEROL | | Descriptor: | Glycerol uptake facilitator protein, octyl beta-D-glucopyranoside | | Authors: | Nollert, P, Miercke, L.J.W, O'Connell, J, Stroud, R.M. | | Deposit date: | 2002-04-08 | | Release date: | 2002-05-08 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Control of the selectivity of the aquaporin water channel family by global orientational tuning.
Science, 296, 2002
|
|
1LDF
 | | CRYSTAL STRUCTURE OF THE E. COLI GLYCEROL FACILITATOR (GLPF) MUTATION W48F, F200T | | Descriptor: | GLYCEROL, Glycerol uptake facilitator protein, MAGNESIUM ION, ... | | Authors: | Nollert, P, Miercke, L.J.W, O'Connell, J, Stroud, R.M. | | Deposit date: | 2002-04-08 | | Release date: | 2002-05-08 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Control of the selectivity of the aquaporin water channel family by global orientational tuning.
Science, 296, 2002
|
|
2VY9
 | | Molecular architecture of the stressosome, a signal integration and transduction hub | | Descriptor: | ANTI-SIGMA-FACTOR ANTAGONIST | | Authors: | Marles-Wright, J, Grant, T, Delumeau, O, van Duinen, G, Firbank, S.J, Lewis, P.J, Murray, J.W, Newman, J.A, Quin, M.B, Race, P.R, Rohou, A, Tichelaar, W, van Heel, M, Lewis, R.J. | | Deposit date: | 2008-07-21 | | Release date: | 2008-10-14 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Molecular Architecture of the "Stressosome," a Signal Integration and Transduction Hub
Science, 322, 2008
|
|
2W2U
 | | STRUCTURAL INSIGHT INTO THE INTERACTION BETWEEN ARCHAEAL ESCRT-III AND AAA-ATPASE | | Descriptor: | CONSERVED ARCHAEAL PROTEIN, HYPOTHETICAL P60 KATANIN | | Authors: | Obita, T, Samson, R.Y, Perisic, O, Freund, S.M, Bell, S.D, Williams, R.L. | | Deposit date: | 2008-11-04 | | Release date: | 2009-07-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | A Role for the Escrt System in Cell Division in Archaea.
Science, 322, 2008
|
|
2VV5
 | | The open structure of MscS | | Descriptor: | SMALL-CONDUCTANCE MECHANOSENSITIVE CHANNEL | | Authors: | Wang, W, Dong, C, Johnson, K.A, Naismith, J.H. | | Deposit date: | 2008-06-03 | | Release date: | 2008-08-05 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3.45 Å) | | Cite: | The Structure of an Open Form of an E. Coli Mechanosensitive Channel at 3.45 A Resolution.
Science, 321, 2008
|
|
2VSQ
 | | Structure of surfactin A synthetase C (SrfA-C), a nonribosomal peptide synthetase termination module | | Descriptor: | LEUCINE, SULFATE ION, SURFACTIN SYNTHETASE SUBUNIT 3 | | Authors: | Tanovic, A, Samel, S.A, Essen, L.-O, Marahiel, M.A. | | Deposit date: | 2008-04-29 | | Release date: | 2008-07-08 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of the termination module of a nonribosomal peptide synthetase.
Science, 321, 2008
|
|
5GRB
 | | Crystal structure of 2C helicase from enterovirus 71 (EV71) bound with ATPgammaS | | Descriptor: | EV71 2C ATPase, PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER, ZINC ION | | Authors: | Guan, H.X, Tian, J, Qin, B, Wojdyla, J, Wang, M.T, Cui, S. | | Deposit date: | 2016-08-09 | | Release date: | 2017-05-17 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.803 Å) | | Cite: | Crystal structure of 2C helicase from enterovirus 71
SCI ADV, 3, 2017
|
|
5GQ1
 | | Crystal structure of 2C helicase from enterovirus 71 (EV71) | | Descriptor: | Genome polyprotein, PHOSPHATE ION, ZINC ION | | Authors: | Guan, H.X, Tian, J, Qin, B, Wojdyla, J, Wang, M.T, Cui, S. | | Deposit date: | 2016-08-05 | | Release date: | 2017-05-17 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.493 Å) | | Cite: | Crystal structure of 2C helicase from enterovirus 71
SCI ADV, 3, 2017
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1I7E
 | | C-Terminal Domain Of Mouse Brain Tubby Protein bound to Phosphatidylinositol 4,5-bis-phosphate | | Descriptor: | L-ALPHA-GLYCEROPHOSPHO-D-MYO-INOSITOL-4,5-BIS-PHOSPHATE, TUBBY PROTEIN | | Authors: | Santagata, S, Boggon, T.J, Baird, C.L, Shan, W.S, Shapiro, L. | | Deposit date: | 2001-03-08 | | Release date: | 2001-06-27 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | G-protein signaling through tubby proteins.
Science, 292, 2001
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1I3Q
 | | RNA POLYMERASE II CRYSTAL FORM I AT 3.1 A RESOLUTION | | Descriptor: | DNA-DIRECTED RNA POLYMERASE II 13.6KD POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II 14.2KD POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II 14.5KD POLYPEPTIDE, ... | | Authors: | Cramer, P, Bushnell, D.A, Kornberg, R.D. | | Deposit date: | 2001-02-15 | | Release date: | 2001-04-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structural basis of transcription: RNA polymerase II at 2.8 angstrom resolution.
Science, 292, 2001
|
|
1I50
 | | RNA POLYMERASE II CRYSTAL FORM II AT 2.8 A RESOLUTION | | Descriptor: | DNA-DIRECTED RNA POLYMERASE II 13.6KD POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II 14.2KD POLYPEPTIDE, DNA-DIRECTED RNA POLYMERASE II 14.5KD POLYPEPTIDE, ... | | Authors: | Cramer, P, Bushnell, D.A, Kornberg, R.D. | | Deposit date: | 2001-02-23 | | Release date: | 2001-04-23 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structural basis of transcription: RNA polymerase II at 2.8 angstrom resolution.
Science, 292, 2001
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1IF0
 | | PSEUDO-ATOMIC MODEL OF BACTERIOPHAGE HK97 PROCAPSID (PROHEAD II) | | Descriptor: | PROTEIN (MAJOR CAPSID PROTEIN GP5) | | Authors: | Conway, J.F, Wikoff, W.R, Cheng, N, Duda, R.L, Hendrix, R.W, Johnson, J.E, Steven, A.C. | | Deposit date: | 2001-04-11 | | Release date: | 2001-05-02 | | Last modified: | 2024-02-07 | | Method: | ELECTRON MICROSCOPY (12 Å) | | Cite: | Virus maturation involving large subunit rotations and local refolding.
Science, 292, 2001
|
|
5JA5
 | | Crystal structure of the rice Topless related protein 2 (TPR2) N-terminal topless domain (1-209) L111A and L130A mutant in complex with rice D53 repressor EAR peptide motif | | Descriptor: | Protein TPR1, The rice D53 peptide (a.a. 794-808), ZINC ION | | Authors: | Ke, J, Ma, H, Gu, X, Brunzelle, J.S, Xu, H.E, Melcher, K. | | Deposit date: | 2016-04-12 | | Release date: | 2017-07-05 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex.
Sci Adv, 3, 2017
|
|
1D6Z
 | | CRYSTAL STRUCTURE OF THE AEROBICALLY FREEZE TRAPPED RATE-DETERMINING CATALYTIC INTERMEDIATE OF E. COLI COPPER-CONTAINING AMINE OXIDASE. | | Descriptor: | 2-PHENYLETHYLAMINE, CALCIUM ION, COPPER (II) ION, ... | | Authors: | Wilmot, C.M, Hajdu, J, McPherson, M.J, Knowles, P.F, Phillips, S.E.V. | | Deposit date: | 1999-10-16 | | Release date: | 2000-02-02 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Visualization of dioxygen bound to copper during enzyme catalysis.
Science, 286, 1999
|
|
