6LER
 
 | | 169 bp nucleosome harboring non-identical cohesive DNA termini. | | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H2A type 1-B/E, ... | | Authors: | Sharma, D, Adhireksan, Z, Lee, P.L, Davey, C.A. | | Deposit date: | 2019-11-26 | | Release date: | 2021-03-03 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies.
Nucleic Acids Res., 49, 2021
|
|
6M4G
 | | Structural mechanism of nucleosome dynamics governed by human histone variants H2A.B and H2A.Z.2.2 | | Descriptor: | DNA (93-MER), Histone H2A-Bbd type 2/3, Histone H2B type 2-E, ... | | Authors: | Zhou, M, Dai, L.C, Li, C.M, Shi, L.X, Huang, Y, Guo, Z.Q. | | Deposit date: | 2020-03-06 | | Release date: | 2020-09-23 | | Last modified: | 2025-06-25 | | Method: | ELECTRON MICROSCOPY (2.8 Å) | | Cite: | Structural basis of nucleosome dynamics modulation by histone variants H2A.B and H2A.Z.2.2.
Embo J., 40, 2021
|
|
9R2P
 | | p53 bound to nucleosome at position SHL+5.9 (crosslinked sample) | | Descriptor: | Cellular tumor antigen p53, DNA-for, DNA-rev, ... | | Authors: | Chakraborty, D, Kater, L, Kempf, G, Cavadini, S, Thoma, N.H. | | Deposit date: | 2025-04-30 | | Release date: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (4.18 Å) | | Cite: | p53 bound to nucleosome at position SHL+5.9 (crosslinked sample)
To Be Published
|
|
9R2Q
 | | p53 bound to nucleosome at position SHL-5.7 (non-crosslinked sample) | | Descriptor: | Cellular tumor antigen p53, DNA-for, DNA-rev, ... | | Authors: | Chakraborty, D, Michael, A.K, Kempf, G, Cavadini, S, Kater, L, Thoma, N.H. | | Deposit date: | 2025-04-30 | | Release date: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | p53 bound to nucleosome at position SHL-5.7 (non-crosslinked sample)
To Be Published
|
|
9R04
 | | p53 bound to the nucleosome at position SHL-5.7 (crosslinked sample) | | Descriptor: | Cellular tumor antigen p53, DNA-for, DNA-rev, ... | | Authors: | Chakraborty, D, Michael, A.K, Kempf, G, Cavadini, S, Kater, L, Thoma, N.H. | | Deposit date: | 2025-04-24 | | Release date: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (4.2 Å) | | Cite: | p53 bound to the nucleosome at position SHL-5.7 (crosslinked sample)
To Be Published
|
|
9R2M
 | | p53 bound to nucleosome at position SHL+5.9 (non-crosslinked sample, composite map) | | Descriptor: | Cellular tumor antigen p53, DNA-for, DNA-rev, ... | | Authors: | Chakraborty, D, Kater, L, Kempf, G, Cavadini, S, Thoma, N.H. | | Deposit date: | 2025-04-30 | | Release date: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | p53 bound to nucleosome at position SHL+5.9 (non-crosslinked sample, composite map)
To Be Published
|
|
8RBX
 | | Structure of Integrator-PP2A bound to a paused RNA polymerase II-DSIF-NELF-nucleosome complex | | Descriptor: | DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit RPB11-a, DNA-directed RNA polymerase II subunit RPB3, ... | | Authors: | Fianu, I, Ochmann, M, Walshe, J.L, Cramer, P. | | Deposit date: | 2023-12-05 | | Release date: | 2024-02-07 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structural basis of Integrator-dependent RNA polymerase II termination.
Nature, 629, 2024
|
|
9QLM
 | | Solution structure of the TAF3-PHD bound to a H3K4me3Q5ser histone tail peptide with a serotonylated glutamine | | Descriptor: | Histone H3.1, SEROTONIN, Transcription initiation factor TFIID subunit 3, ... | | Authors: | van Ingen, H, Gielingh, H, Pulido-Cortes, L, Thijssen, V, Timmers, H.Th.M, Jongkees, S, Honorato, R.V, Bonvin, A.M.J.J, Liu, M, Yoshisada, R, Soares, L.R. | | Deposit date: | 2025-03-21 | | Release date: | 2025-05-14 | | Method: | SOLUTION NMR | | Cite: | Molecular determinants for recognition of serotonylated chromatin
To Be Published
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
9L22
 | | hDEK-nucleosome complex (conformation 2) | | Descriptor: | 601 DNA (189-MER), 601 DNA_R (189-MER), Histone H2A type 1-B/E, ... | | Authors: | Liu, Y, Wang, C, Huang, H. | | Deposit date: | 2024-12-16 | | Release date: | 2025-05-07 | | Last modified: | 2025-06-18 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | DEK-nucleosome structure shows DEK modulates H3K27me3 and stem cell fate.
Nat.Struct.Mol.Biol., 2025
|
|
9L1X
 | | hDEK-nucleosome complex (conformation 1) | | Descriptor: | 601 DNA (189-MER), 601 DNA_R (189-MER), Histone H2A type 1-B/E, ... | | Authors: | Liu, Y, Wang, C, Huang, H. | | Deposit date: | 2024-12-16 | | Release date: | 2025-05-07 | | Last modified: | 2025-06-25 | | Method: | ELECTRON MICROSCOPY (2.69 Å) | | Cite: | DEK-nucleosome structure shows DEK modulates H3K27me3 and stem cell fate.
Nat.Struct.Mol.Biol., 2025
|
|
8ATF
 | | Nucleosome-bound Ino80 ATPase | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA (226-MER), DNA (227-MER), ... | | Authors: | Kunert, F, Metzner, F.J, Eustermann, S, Jung, J, Woike, S, Schall, K, Kostrewa, D, Hopfner, K.P. | | Deposit date: | 2022-08-23 | | Release date: | 2022-12-14 | | Last modified: | 2024-07-24 | | Method: | ELECTRON MICROSCOPY (3.45 Å) | | Cite: | Structural mechanism of extranucleosomal DNA readout by the INO80 complex.
Sci Adv, 8, 2022
|
|
8AV6
 | | CryoEM structure of INO80 core nucleosome complex in closed grappler conformation | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, ADENOSINE-5'-TRIPHOSPHATE, DASH complex subunit DAD4, ... | | Authors: | Kunert, F, Metzner, F.J, Eustermann, S, Jung, J, Woike, S, Schall, K, Kostrewa, D, Hopfner, K.P. | | Deposit date: | 2022-08-26 | | Release date: | 2022-12-14 | | Last modified: | 2024-07-24 | | Method: | ELECTRON MICROSCOPY (4.68 Å) | | Cite: | Structural mechanism of extranucleosomal DNA readout by the INO80 complex.
Sci Adv, 8, 2022
|
|
4LD9
 | | Crystal structure of the N-terminally acetylated BAH domain of Sir3 bound to the nucleosome core particle | | Descriptor: | Histone H2A, Histone H2B 1.1, Histone H3.2, ... | | Authors: | Arnaudo, N, Fernandez, I.S, McLaughlin, S.H, Peak-Chew, S.Y, Rhodes, D, Martino, F. | | Deposit date: | 2013-06-24 | | Release date: | 2013-08-14 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (3.306 Å) | | Cite: | The N-terminal acetylation of Sir3 stabilizes its binding to the nucleosome core particle.
Nat.Struct.Mol.Biol., 20, 2013
|
|
6T7D
 | | Structure of human Sox11 transcription factor in complex with a nucleosome | | Descriptor: | DNA (151-MER), Histone H2A type 1-B/E, Histone H2B type 1-K, ... | | Authors: | Dodonova, S.O, Zhu, F, Dienemann, C, Taipale, J, Cramer, P. | | Deposit date: | 2019-10-21 | | Release date: | 2020-04-29 | | Last modified: | 2024-05-22 | | Method: | ELECTRON MICROSCOPY (4.4 Å) | | Cite: | Nucleosome-bound SOX2 and SOX11 structures elucidate pioneer factor function.
Nature, 580, 2020
|
|
6T7C
 | | Structure of two copies of human Sox11 transcription factor in complex with a nucleosome | | Descriptor: | DNA (147-MER), Histone H2A type 1-B/E, Histone H2B type 1-K, ... | | Authors: | Dodonova, S.O, Zhu, F, Dienemann, C, Taipale, J, Cramer, P. | | Deposit date: | 2019-10-21 | | Release date: | 2020-04-29 | | Last modified: | 2024-05-22 | | Method: | ELECTRON MICROSCOPY (4 Å) | | Cite: | Nucleosome-bound SOX2 and SOX11 structures elucidate pioneer factor function.
Nature, 580, 2020
|
|
9LIU
 | | Structure of isw1-nucleosome double-bound complex in ATP-ATP state | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DNA (146-MER), Histone H2A, ... | | Authors: | Sia, Y, Pan, H, Chen, Z. | | Deposit date: | 2025-01-14 | | Release date: | 2025-04-09 | | Last modified: | 2025-06-18 | | Method: | ELECTRON MICROSCOPY (2.7 Å) | | Cite: | Structural insights into chromatin remodeling by ISWI during active ATP hydrolysis.
Science, 388, 2025
|
|
6KW5
 | | The ClassC RSC-Nucleosome Complex | | Descriptor: | Actin-like protein ARP9, Actin-related protein 7, Chromatin structure-remodeling complex protein RSC3, ... | | Authors: | Ye, Y.P, Wu, H, Chen, K.J, Verma, N, Cairns, B, Gao, N, Chen, Z.C. | | Deposit date: | 2019-09-06 | | Release date: | 2020-09-09 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (10.13 Å) | | Cite: | Structure of the RSC complex bound to the nucleosome
To Be Published
|
|
6TDA
 | | Structure of SWI/SNF chromatin remodeler RSC bound to a nucleosome | | Descriptor: | Actin-like protein ARP9, Actin-related protein 7, Chromatin structure-remodeling complex protein RSC58, ... | | Authors: | Wagner, F.R, Dienemann, C, Wang, H, Stuetzer, A, Tegunov, D, Urlaub, H, Cramer, P. | | Deposit date: | 2019-11-08 | | Release date: | 2020-03-18 | | Last modified: | 2024-11-13 | | Method: | ELECTRON MICROSCOPY (15 Å) | | Cite: | Structure of SWI/SNF chromatin remodeller RSC bound to a nucleosome.
Nature, 579, 2020
|
|
6KW4
 | | The ClassB RSC-Nucleosome Complex | | Descriptor: | Actin-like protein ARP9, Actin-related protein 7, Chromatin structure-remodeling complex protein RSC3, ... | | Authors: | Ye, Y.P, Wu, H, Chen, K.J, Verma, N, Cairns, B, Gao, N, Chen, Z.C. | | Deposit date: | 2019-09-06 | | Release date: | 2019-11-13 | | Last modified: | 2024-05-29 | | Method: | ELECTRON MICROSCOPY (7.55 Å) | | Cite: | Structure of the RSC complex bound to the nucleosome.
Science, 366, 2019
|
|
8EVG
 | |
8EVJ
 | | CX3CR1 nucleosome bound PU.1 and C/EBPa | | Descriptor: | DNA (167-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | | Authors: | Guan, R, Bai, Y, Lian, T. | | Deposit date: | 2022-10-20 | | Release date: | 2023-11-01 | | Last modified: | 2024-10-30 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structural mechanism of synergistic targeting of the CX3CR1 nucleosome by PU.1 and C/EBP alpha.
Nat.Struct.Mol.Biol., 31, 2024
|
|
8EVI
 | | CX3CR1 nucleosome and PU.1 complex containing disulfide bond mutations | | Descriptor: | DNA (167-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | | Authors: | Lian, T, Guan, R, Bai, Y. | | Deposit date: | 2022-10-20 | | Release date: | 2023-11-01 | | Last modified: | 2024-10-23 | | Method: | ELECTRON MICROSCOPY (2.64 Å) | | Cite: | Structural mechanism of synergistic targeting of the CX3CR1 nucleosome by PU.1 and C/EBP alpha.
Nat.Struct.Mol.Biol., 31, 2024
|
|
