7OTC
| Cryo-EM structure of an Escherichia coli 70S ribosome in complex with elongation factor G and the antibiotic Argyrin B | Descriptor: | 1,4-DIAMINOBUTANE, 16S ribosomal RNA, 23S ribosomal RNA, ... | Authors: | Wieland, M, Koller, T.O, Wilson, D.N. | Deposit date: | 2021-06-10 | Release date: | 2022-05-11 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | The cyclic octapeptide antibiotic argyrin B inhibits translation by trapping EF-G on the ribosome during translocation. Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
7PJY
| Structure of the 70S-EF-G-GDP ribosome complex with tRNAs in chimeric state 1 (CHI1-EF-G-GDP) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-10-20 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
7PJW
| Structure of the 70S-EF-G-GDP-Pi ribosome complex with tRNAs in hybrid state 2 (H2-EF-G-GDP-Pi) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-10-20 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (4 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
7PJX
| Structure of the 70S-EF-G-GDP ribosome complex with tRNAs in hybrid state 1 (H1-EF-G-GDP) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-10-20 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (6.5 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
7PJV
| Structure of the 70S-EF-G-GDP-Pi ribosome complex with tRNAs in hybrid state 1 (H1-EF-G-GDP-Pi) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-10-20 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
7PJT
| Structure of the 70S ribosome with tRNAs in hybrid state 1 (H1) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-10-20 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (6 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
7PJU
| Structure of the 70S ribosome with tRNAs in hybrid state 2 (H2) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-11-17 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (9.5 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
7PJZ
| Structure of the 70S-EF-G-GDP ribosome complex with tRNAs in chimeric state 2 (CHI2-EF-G-GDP) | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Petrychenko, V, Peng, B.Z, Schwarzer, A.C, Peske, F, Rodnina, M.V, Fischer, N. | Deposit date: | 2021-08-24 | Release date: | 2021-10-20 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (6 Å) | Cite: | Structural mechanism of GTPase-powered ribosome-tRNA movement. Nat Commun, 12, 2021
|
|
5AFI
| 2.9A Structure of E. coli ribosome-EF-TU complex by cs-corrected cryo-EM | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Fischer, N, Neumann, P, Konevega, A.L, Bock, L.V, Ficner, R, Rodnina, M.V, Stark, H. | Deposit date: | 2015-01-22 | Release date: | 2015-03-11 | Last modified: | 2024-04-24 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Structure of the E. coli ribosome-EF-Tu complex at <3 angstrom resolution by Cs-corrected cryo-EM. Nature, 520, 2015
|
|
4Y4P
| Crystal structure of the Thermus thermophilus 70S ribosome with rRNA modifications and bound to mRNA and A-, P- and E-site tRNAs at 2.5A resolution | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Polikanov, Y.S, Melnikov, S.V, Soll, D, Steitz, T.A. | Deposit date: | 2015-02-10 | Release date: | 2015-03-18 | Last modified: | 2019-12-25 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structural insights into the role of rRNA modifications in protein synthesis and ribosome assembly. Nat.Struct.Mol.Biol., 22, 2015
|
|
4YBB
| High-resolution structure of the Escherichia coli ribosome | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1,2-ETHANEDIOL, 1,4-DIAMINOBUTANE, ... | Authors: | Noeske, J, Wasserman, M.R, Terry, D.S, Altman, R.B, Blanchard, S.C, Cate, J.H.D. | Deposit date: | 2015-02-18 | Release date: | 2015-03-18 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | High-resolution structure of the Escherichia coli ribosome. Nat.Struct.Mol.Biol., 22, 2015
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
5JPQ
| Cryo-EM structure of the 90S pre-ribosome | Descriptor: | 18S ribosomal RNA, Bms1, Emg1, ... | Authors: | Turk, M, Cheng, J, Berninghausen, O, Kornprobst, M, Flemming, D, Kos-Braun, I.C, Kos, M, Thoms, M, Hurt, E, Beckmann, R. | Deposit date: | 2016-05-04 | Release date: | 2016-07-27 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (7.3 Å) | Cite: | Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome. Cell, 166, 2016
|
|
5A2Q
| Structure of the HCV IRES bound to the human ribosome | Descriptor: | 18S RRNA, HCV IRES, MAGNESIUM ION, ... | Authors: | Quade, N, Leiundgut, M, Boehringer, D, Heuvel, J.v.d, Ban, N. | Deposit date: | 2015-05-21 | Release date: | 2015-07-15 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Cryo-Em Structure of Hepatitis C Virus Ires Bound to the Human Ribosome at 3.9 Angstrom Resolution Nat.Commun., 6, 2015
|
|
4Y4O
| Crystal structure of the Thermus thermophilus 70S ribosome with rRNA modifications and bound to protein Y (YfiA) at 2.3A resolution | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 16S Ribosomal RNA, 23S Ribosomal RNA, ... | Authors: | Polikanov, Y.S, Melnikov, S.V, Soll, D, Steitz, T.A. | Deposit date: | 2015-02-10 | Release date: | 2015-03-18 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structural insights into the role of rRNA modifications in protein synthesis and ribosome assembly. Nat.Struct.Mol.Biol., 22, 2015
|
|
5ADY
| Cryo-EM structures of the 50S ribosome subunit bound with HflX | Descriptor: | 23S RRNA, 50S RIBOSOMAL PROTEIN L1, 50S RIBOSOMAL PROTEIN L10, ... | Authors: | Zhang, Y, Mandava, C.S, Cao, W, Li, X, Zhang, D, Li, N, Zhang, Y, Zhang, X, Qin, Y, Mi, K, Lei, J, Sanyal, S, Gao, N. | Deposit date: | 2015-08-25 | Release date: | 2015-10-14 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (4.5 Å) | Cite: | Hflx is a Ribosome Splitting Factor Rescuing Stalled Ribosomes Under Stress Conditions Nat.Struct.Mol.Biol., 22, 2015
|
|
5A9Z
| Complex of Thermous thermophilus ribosome bound to BipA-GDPCP | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | Authors: | Kumar, V, Chen, Y, Ahmed, T, Tan, J, Ero, R, Bhushan, S, Gao, Y.-G. | Deposit date: | 2015-07-23 | Release date: | 2015-10-14 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (4.7 Å) | Cite: | Structure of Bipa in GTP Form Bound to the Ratcheted Ribosome. Proc.Natl.Acad.Sci.USA, 112, 2015
|
|
5AA0
| Complex of Thermous thermophilus ribosome (A-and P-site tRNA) bound to BipA-GDPCP | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 3'-amino-3'-deoxyadenosine 5'-(dihydrogen phosphate), ... | Authors: | Kumar, V, Chen, Y, Ahmed, T, Tan, J, Ero, R, Bhushan, S, Gao, Y.-G. | Deposit date: | 2015-07-23 | Release date: | 2015-10-14 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (5 Å) | Cite: | Structure of Bipa in GTP Form Bound to the Ratcheted Ribosome. Proc.Natl.Acad.Sci.USA, 112, 2015
|
|
4Z3S
| Crystal structure of the Thermus thermophilus 70S ribosome in complex with antibiotic A201A, mRNA and three tRNAs in the A, P and E sites at 2.65A resolution | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 3'-deoxy-3'-{[(2E)-3-(4-{[(4Z)-6-O-(6-deoxy-3,4-di-O-methyl-alpha-D-mannopyranosyl)-5-O-methyl-alpha-D-threo-hex-4-enofuranosyl]oxy}phenyl)-2-methylprop-2-enoyl]amino}-N,N-dimethyladenosine, ... | Authors: | Polikanov, Y.S, Starosta, A.L, Juette, M.F, Altman, R.B, Terry, D.S, Lu, W, Burnett, B.J, Dinos, G, Reynolds, K, Blanchard, S.C, Steitz, T.A, Wilson, D.N. | Deposit date: | 2015-03-31 | Release date: | 2015-06-03 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Distinct tRNA Accommodation Intermediates Observed on the Ribosome with the Antibiotics Hygromycin A and A201A. Mol.Cell, 58, 2015
|
|
5APN
| Structure of the yeast 60S ribosomal subunit in complex with Arx1, Alb1 and N-terminally tagged Rei1 | Descriptor: | 25S rRNA, 5.8S rRNA, 5S rRNA, ... | Authors: | Greber, B.J, Gerhardy, S, Leitner, A, Leibundgut, M, Salem, M, Boehringer, D, Leulliot, N, Aebersold, R, Panse, V.G, Ban, V. | Deposit date: | 2015-09-17 | Release date: | 2015-12-16 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.91 Å) | Cite: | Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. Cell, 164, 2015
|
|
5APO
| Structure of the yeast 60S ribosomal subunit in complex with Arx1, Alb1 and C-terminally tagged Rei1 | Descriptor: | 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Greber, B.J, Gerhardy, S, Leitner, A, Leibundgut, M, Salem, M, Boehringer, D, Leulliot, N, Aebersold, R, Panse, V.G, Ban, N. | Deposit date: | 2015-09-17 | Release date: | 2015-12-16 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.41 Å) | Cite: | Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. Cell(Cambridge,Mass.), 164, 2016
|
|
4YHH
| Crystal structure of the 30S ribosomal subunit from Thermus thermophilus in complex with tigecycline | Descriptor: | 16S ribosomal RNA, 30S ribosomal protein S10, 30S ribosomal protein S11, ... | Authors: | Schedlbauer, A, Kaminishi, T, Ochoa-Lizarralde, B, Dhimole, N, Zhou, S, Lopez-Alonso, J.P, Connell, S.R, Fucini, P. | Deposit date: | 2015-02-27 | Release date: | 2015-04-08 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.417 Å) | Cite: | Structural characterization of an alternative mode of tigecycline binding to the bacterial ribosome. Antimicrob.Agents Chemother., 59, 2015
|
|
5X8P
| Structure of the 70S chloroplast ribosome from spinach | Descriptor: | 16S rRNA, 23S rRNA, 30S ribosomal protein S1, ... | Authors: | Ahmed, T, Shi, J, Bhushan, S. | Deposit date: | 2017-03-03 | Release date: | 2017-06-14 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Unique localization of the plastid-specific ribosomal proteins in the chloroplast ribosome small subunit provides mechanistic insights into the chloroplastic translation Nucleic Acids Res., 45, 2017
|
|
5XY3
| Large subunit of Trichomonas vaginalis ribosome | Descriptor: | 25S ribosomal RNA, 5.8S ribosomal RNA, 5S ribosomal RNA, ... | Authors: | Li, Z, Guo, Q, Zheng, L, Ji, Y, Xie, Y, Lai, D, Lun, Z, Suo, X, Gao, N. | Deposit date: | 2017-07-06 | Release date: | 2017-08-30 | Last modified: | 2019-12-18 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii Cell Res., 27, 2017
|
|
5Z3G
| Cryo-EM structure of a nucleolar pre-60S ribosome (Rpf1-TAP) | Descriptor: | 25S rRNA, 5.8S rRNA, 60S ribosomal protein L13-A, ... | Authors: | Zhu, X, Zhou, D, Ye, K. | Deposit date: | 2018-01-06 | Release date: | 2018-04-11 | Last modified: | 2019-11-06 | Method: | ELECTRON MICROSCOPY (3.65 Å) | Cite: | Cryo-EM structure of an early precursor of large ribosomal subunit reveals a half-assembled intermediate. Protein Cell, 10, 2019
|
|