3EJ1
 
 | | CDK2/CyclinA complexed with a pyrazolopyridazine inhibitor | | Descriptor: | Cell division protein kinase 2, Cyclin-A2, N-cyclopropyl-4-pyrazolo[1,5-b]pyridazin-3-ylpyrimidin-2-amine | | Authors: | Stevens, K, Reno, M, Alberti, J, Price, D, Kane-Carson, L, Knick, V, Shewchuk, L, Hassell, A, Veal, J, Peel, M. | | Deposit date: | 2008-09-17 | | Release date: | 2008-10-21 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (3.22 Å) | | Cite: | Synthesis and evaluation of pyrazolo[1,5-b]pyridazines as selective cyclin dependent kinase inhibitors.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
159D
 | | SIDE BY SIDE BINDING OF TWO DISTAMYCIN A DRUGS IN THE MINOR GROOVE OF AN ALTERNATING B-DNA DUPLEX | | Descriptor: | DISTAMYCIN A, DNA (5'-D(*IP*CP*IP*CP*IP*CP*IP*C)-3'), MAGNESIUM ION | | Authors: | Chen, X, Ramakrishnan, B, Rao, S.T, Sundaralingam, M. | | Deposit date: | 1994-02-10 | | Release date: | 1995-02-07 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Binding of two distamycin A molecules in the minor groove of an alternating B-DNA duplex.
Nat.Struct.Biol., 1, 1994
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1KTI
 | | BINDING OF 100 MM N-ACETYL-N'-BETA-D-GLUCOPYRANOSYL UREA TO GLYCOGEN PHOSPHORYLASE B: KINETIC AND CRYSTALLOGRAPHIC STUDIES | | Descriptor: | GLYCOGEN PHOSPHORYLASE, MUSCLE FORM, N-(acetylcarbamoyl)-beta-D-glucopyranosylamine, ... | | Authors: | Oikonomakos, N.G, Kosmopoulou, M, Zographos, S.E, Leonidas, D.D, Chrysina, E.D, Somsak, L, Nagy, V, Praly, J.P, Docsa, T, Toth, B, Gergely, P. | | Deposit date: | 2002-01-16 | | Release date: | 2002-01-30 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.97 Å) | | Cite: | Binding of N-acetyl-N'-beta-D-glucopyranosyl urea and N-benzoyl-N'-beta-D-glucopyranosyl urea to glycogen phosphorylase b: kinetic and crystallographic studies.
Eur.J.Biochem., 269, 2002
|
|
3EID
 | | CDK2/CyclinA complexed with a pyrazolopyridazine inhibitor | | Descriptor: | (2S)-1-(dimethylamino)-3-(4-{[4-(6-morpholin-4-ylpyrazolo[1,5-b]pyridazin-3-yl)pyrimidin-2-yl]amino}phenoxy)propan-2-ol, Cell division protein kinase 2, Cyclin-A2 | | Authors: | Steven, K, Reno, M, Alberti, J, Price, D, Kane-Carson, L, Knick, V, Shewchuk, L, Hassell, A, Veal, J, Peel, M. | | Deposit date: | 2008-09-15 | | Release date: | 2008-10-21 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | Synthesis and evaluation of pyrazolo[1,5-b]pyridazines as selective cyclin dependent kinase inhibitors.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
2R76
 | | Crystal structure of the rare lipoprotein B (SO_1173) from Shewanella oneidensis, Northeast Structural Genomics Consortium Target SoR91A | | Descriptor: | Rare lipoprotein B | | Authors: | Forouhar, F, Chen, Y, Seetharaman, J, Mao, L, Maglaqui, M, Owen, L.A, Cunningham, K, Fang, Y, Xiao, R, Baran, M.C, Acton, T.B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2007-09-07 | | Release date: | 2007-09-25 | | Last modified: | 2017-10-25 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of the rare lipoprotein B (SO_1173) from Shewanella oneidensis.
To be Published
|
|
5XEZ
 | | Structure of the Full-length glucagon class B G protein-coupled receptor | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, 4-{[(4-cyclohexylphenyl){[3-(methylsulfonyl)phenyl]carbamoyl}amino]methyl}-N-(1H-tetrazol-5-yl)benzamide, ... | | Authors: | Zhang, H, Qiao, A, Yang, D, Yang, L, Dai, A, de Graaf, C, Reedtz-Runge, S, Dharmarajan, V, Zhang, H, Han, G.W, Grant, T, Sierra, R, Weierstall, U, Nelson, G, Liu, W, Wu, Y, Ma, L, Cai, X, Lin, G, Wu, X, Geng, Z, Dong, Y, Song, G, Griffin, P, Lau, J, Cherezov, V, Yang, H, Hanson, M, Stevens, R, Jiang, H, Wang, M, Zhao, Q, Wu, B. | | Deposit date: | 2017-04-06 | | Release date: | 2017-05-24 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structure of the full-length glucagon class B G-protein-coupled receptor.
Nature, 546, 2017
|
|
3NY5
 | | Crystal structure of the RBD domain of serine/threonine-protein kinase B-raf from Homo sapiens. Northeast Structural Genomics Consortium Target HR4694F | | Descriptor: | Serine/threonine-protein kinase B-raf | | Authors: | Vorobiev, S, Su, M, Seetharaman, J, Patel, P, Xiao, R, Ciccosanti, C, Shastry, R, Everett, J.K, Nair, R, Acton, T.B, Rost, B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2010-07-14 | | Release date: | 2010-07-28 | | Last modified: | 2017-10-25 | | Method: | X-RAY DIFFRACTION (1.993 Å) | | Cite: | Crystal structure of the RBD domain of serine/threonine-protein kinase B-raf from Homo sapiens.
To be Published
|
|
1AQ7
 | |
5D6P
 | | Crystal structure of the ATP binding domain of S. aureus GyrB complexed with a ligand | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1-ethyl-3-[4-(hydroxymethyl)-5-(1H-pyrrol-2-yl)-1,3-thiazol-2-yl]urea, DNA gyrase subunit B, ... | | Authors: | Zhang, J, Yang, Q, Cross, J.B, Romero, J.A.C, Ryan, M.D, Lippa, B, Dolle, R.E, Andersen, O.A, Barker, J, Cheng, R.K, Kahmann, J, Felicetti, B, Wood, M, Scheich, C. | | Deposit date: | 2015-08-12 | | Release date: | 2015-11-25 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Discovery of Azaindole Ureas as a Novel Class of Bacterial Gyrase B Inhibitors.
J.Med.Chem., 58, 2015
|
|
3JV6
 | |
3ZDI
 | | Glycogen Synthase Kinase 3 Beta complexed with Axin Peptide and Inhibitor 7d | | Descriptor: | 3,6-Diamino-4-(2-chlorophenyl)thieno[2,3-b]pyridine-2,5-dicarbonitrile, AXIN-1, GLYCOGEN SYNTHASE KINASE-3 BETA, ... | | Authors: | Oberholzer, A.E, Pearl, L.H. | | Deposit date: | 2012-11-27 | | Release date: | 2012-12-26 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.645 Å) | | Cite: | 3,6-Diamino-4-(2-Halophenyl)-2-Benzoylthieno(2,3-B) Pyridine-5-Carbonitriles are Selective Inhibitors of Plasmodium Falciparum Glycogen Synthase Kinase-3 (Pfgsk-3)
J.Med.Chem., 56, 2013
|
|
4HFX
 | | Crystal structure of a transcription elongation factor B polypeptide 3 from Homo sapiens, Northeast Structural Genomics consortium target id HR4748B. | | Descriptor: | SULFATE ION, Transcription elongation factor B polypeptide 3 | | Authors: | Seetharaman, J, Su, M, Ciccosanti, C, Sahdev, S, Acton, T.B, Xiao, R, Everett, J.K, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2012-10-05 | | Release date: | 2012-12-12 | | Last modified: | 2018-01-24 | | Method: | X-RAY DIFFRACTION (2.54 Å) | | Cite: | Crystal structure of a transcription elongation factor B polypeptide 3 from Homo sapiens, Northeast Structural Genomics consortium target id HR4748B. (CASP Target)
TO BE PUBLISHED
|
|
5DEG
 | | Crystal structure of B*27:06 bound to the pVIPR peptide | | Descriptor: | Beta-2-microglobulin, GLYCEROL, MHC class I antigen, ... | | Authors: | Loll, B, Fabian, H, Hee, C.S, Huser, H, Uchanska-Ziegler, B, Ziegler, A. | | Deposit date: | 2015-08-25 | | Release date: | 2015-11-18 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.83 Å) | | Cite: | Increased Conformational Flexibility of HLA-B*27 Subtypes Associated With Ankylosing Spondylitis.
Arthritis Rheumatol, 68, 2016
|
|
3BP9
 | | Structure of B-tropic MLV capsid N-terminal domain | | Descriptor: | GLYCEROL, Gag protein, ISOPROPYL ALCOHOL | | Authors: | Gulnahar, M.B, Dodding, M.P, Goldstone, D.C, Haire, L.F, Stoye, J.P, Taylor, I.A. | | Deposit date: | 2007-12-18 | | Release date: | 2008-02-12 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structure of B-MLV capsid amino-terminal domain reveals key features of viral tropism, gag assembly and core formation
J.Mol.Biol., 376, 2008
|
|
4E4X
 | | Crystal Structure of B-Raf Kinase Domain in Complex with a Dihydropyrido[2,3-d]pyrimidinone-based Inhibitor | | Descriptor: | N-(2,4-difluoro-3-{2-[(3-hydroxypropyl)amino]-8-methyl-7-oxo-7,8-dihydropyrido[2,3-d]pyrimidin-6-yl}phenyl)propane-1-sulfonamide, Serine/threonine-protein kinase B-raf | | Authors: | Voegtli, W.C, Sturgis, H.L. | | Deposit date: | 2012-03-13 | | Release date: | 2012-05-09 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (3.6 Å) | | Cite: | The discovery of potent and selective pyridopyrimidin-7-one based inhibitors of B-Raf(V600E) kinase.
Bioorg.Med.Chem.Lett., 22, 2012
|
|
7XQ8
 | | Structure of human B-cell antigen receptor of the IgM isotype | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, B-cell antigen receptor complex-associated protein alpha chain, B-cell antigen receptor complex-associated protein beta chain, ... | | Authors: | Chen, M.Y, Su, Q, Shi, Y.G. | | Deposit date: | 2022-05-07 | | Release date: | 2022-08-17 | | Last modified: | 2022-08-31 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Cryo-EM structure of the human IgM B cell receptor.
Science, 377, 2022
|
|
6GF3
 | | Tubulin-Jerantinine B acetate complex | | Descriptor: | 1,2-ETHANEDIOL, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, CALCIUM ION, ... | | Authors: | Smedley, C.J, Stanley, P.A, Qazzaz, M.E, Prota, A.E, Olieric, N, Collins, H, Eastman, H, Barrow, A.S, Lim, K.-H, Kam, T.-S, Smith, B.J, Duivenvoorden, H.M, Parker, B.S, Bradshaw, T.D, Steinmetz, M.O, Moses, J.E. | | Deposit date: | 2018-04-29 | | Release date: | 2019-05-08 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Sustainable Syntheses of (-)-Jerantinines A & E and Structural Characterisation of the Jerantinine-Tubulin Complex at the Colchicine Binding Site.
Sci Rep, 8, 2018
|
|
4RX6
 | | Structure of B. subtilis GlnK-ATP complex to 2.6 Angstrom | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Nitrogen regulatory PII-like protein | | Authors: | Schumacher, M.A, Cuthbert, B, Tonthat, N, Chinnam, N.G, Whitfill, T. | | Deposit date: | 2014-12-09 | | Release date: | 2015-12-30 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.5994 Å) | | Cite: | Structures of regulatory machinery reveal novel molecular mechanisms controlling B. subtilis nitrogen homeostasis.
Genes Dev., 29, 2015
|
|
3CVK
 | | Crystal structure of HCV NS5B polymerase with a novel pyridazinone inhibitor | | Descriptor: | N-{3-[1-(3,3-Dimethyl-butyl)-4-hydroxy-2-oxo-1,2,4a,5,6,7-hexahydro-pyrrolo[1,2-b]pyridazin-3-yl]-1,1-dioxo-1,2-dihydro -1lambda6-benzo[1,2,4]thiadiazin-7-yl}-methanesulfonamide, RNA-directed RNA polymerase | | Authors: | Zhao, Q, Showalter, R.E, Han, Q, Kissinger, C.R. | | Deposit date: | 2008-04-18 | | Release date: | 2009-04-21 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.31 Å) | | Cite: | Hexahydro-pyrrolo- and hexahydro-1H-pyrido[1,2-b]pyridazin-2-ones as potent inhibitors of HCV NS5B polymerase.
Bioorg.Med.Chem.Lett., 18, 2008
|
|
2JA4
 | | Crystal structure of CD5 domain III reveals the fold of a group B scavenger cysteine-rich receptor | | Descriptor: | T-CELL SURFACE GLYCOPROTEIN CD5 | | Authors: | Rodamilans, B, Munoz, I.G, Sarrias, M.R, Lozano, F, Blanco, F.J, Montoya, G. | | Deposit date: | 2006-11-21 | | Release date: | 2007-03-06 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Crystal Structure of the Third Extracellular Domain of Cd5 Reveals the Fold of a Group B Scavenger Cysteine-Rich Receptor Domain.
J.Biol.Chem., 282, 2007
|
|
1C3B
 | | AMPC BETA-LACTAMASE FROM E. COLI COMPLEXED WITH INHIBITOR, BENZO(B)THIOPHENE-2-BORONIC ACID (BZB) | | Descriptor: | BENZO[B]THIOPHENE-2-BORONIC ACID, CEPHALOSPORINASE | | Authors: | Powers, R.A, Blazquez, J, Weston, G.S, Morosini, M.I, Baquero, F, Shoichet, B.K. | | Deposit date: | 1999-07-27 | | Release date: | 1999-11-24 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | The complexed structure and antimicrobial activity of a non-beta-lactam inhibitor of AmpC beta-lactamase.
Protein Sci., 8, 1999
|
|
2JXP
 | | Solution NMR structure of uncharacterized lipoprotein B from Nitrosomonas europaea. Northeast Structural Genomics target NeR45A | | Descriptor: | Putative lipoprotein B | | Authors: | Rossi, P, Wang, D, Janjua, H, Owens, L, Xiao, R, Baran, M.C, Swapna, G, Acton, T.B, Rost, B, Montelione, G.T, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2007-11-27 | | Release date: | 2007-12-11 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Solution NMR structure of uncharacterized lipoprotein B from Nitrosomonas europaea.
To be Published
|
|
1XHA
 | | Crystal Structures of Protein Kinase B Selective Inhibitors in Complex with Protein Kinase A and Mutants | | Descriptor: | N-{4-[(4-{3-[(2R)-3,3-DIMETHYLPIPERIDIN-2-YL]-2-FLUORO-6-HYDROXYBENZOYL}BENZOYL)AMINO]AZEPAN-3-YL}ISONICOTINAMIDE, cAMP-dependent protein kinase inhibitor, alpha form, ... | | Authors: | Breitenlechner, C.B, Friebe, W.-G, Brunet, E, Werner, G, Graul, K, Thomas, U, Kuenkele, K.-P, Schaefer, W, Gassel, M, Bossemeyer, D, Huber, R, Engh, R.A, Masjost, B. | | Deposit date: | 2004-09-17 | | Release date: | 2005-09-17 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.46 Å) | | Cite: | Design and crystal structures of protein kinase B-selective inhibitors in complex with protein kinase A and mutants
J.Med.Chem., 48, 2005
|
|
