1LHE
 
 | | HUMAN ALPHA-THROMBIN COMPLEXED WITH AC-(D)PHE-PRO-BORO-N-BUTYL-AMIDINO-GLYCINE-OH | | Descriptor: | AC-(D)PHE-PRO-BORO-N-BUTYL-AMIDINO-GLYCINE-OH, ALPHA-THROMBIN, HIRUDIN | | Authors: | Weber, P.C, Lee, S.L, Lewandowski, F.A, Schadt, M.C, Chang, C.H, Kettner, C.A. | | Deposit date: | 1994-12-27 | | Release date: | 1996-11-08 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Kinetic and crystallographic studies of thrombin with Ac-(D)Phe-Pro-boroArg-OH and its lysine, amidine, homolysine, and ornithine analogs.
Biochemistry, 34, 1995
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
5C7M
 | | CRYSTAL STRUCTURE OF E3 LIGASE ITCH WITH A UB VARIANT | | Descriptor: | E3 ubiquitin-protein ligase Itchy homolog, Polyubiquitin-C | | Authors: | Walker, J.R, Hu, J, Dong, A, Wernimont, A, Zhang, W, Sidhu, S, Bountra, C, Edwards, A.M, Arrowsmith, C.H, Tong, Y, Structural Genomics Consortium (SGC) | | Deposit date: | 2015-06-24 | | Release date: | 2016-03-16 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (3.03 Å) | | Cite: | System-Wide Modulation of HECT E3 Ligases with Selective Ubiquitin Variant Probes.
Mol.Cell, 62, 2016
|
|
1LHD
 | | HUMAN ALPHA-THROMBIN COMPLEXED WITH AC-(D)PHE-PRO-BOROLYS-OH | | Descriptor: | AC-(D)PHE-PRO-BOROLYS-OH, ALPHA-THROMBIN, HIRUDIN | | Authors: | Weber, P.C, Lee, S.L, Lewandowski, F.A, Schadt, M.C, Chang, C.H, Kettner, C.A. | | Deposit date: | 1994-12-27 | | Release date: | 1996-11-08 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Kinetic and crystallographic studies of thrombin with Ac-(D)Phe-Pro-boroArg-OH and its lysine, amidine, homolysine, and ornithine analogs.
Biochemistry, 34, 1995
|
|
5CP4
 | | CRYOGENIC STRUCTURE OF P450CAM | | Descriptor: | CAMPHOR, CYTOCHROME P450CAM, GLYCEROL, ... | | Authors: | Li, H, Poulos, T.L. | | Deposit date: | 1998-05-28 | | Release date: | 1998-09-16 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Understanding the role of the essential Asp251 in cytochrome p450cam using site-directed mutagenesis, crystallography, and kinetic solvent isotope effect.
Biochemistry, 37, 1998
|
|
1GVZ
 | | Prostate Specific Antigen (PSA) from stallion seminal plasma | | Descriptor: | ACETATE ION, GLYCEROL, KALLIKREIN-1E2 | | Authors: | Carvalho, A.L, Sanz, L, Barettino, D, Romero, A, Calvete, J.J, Romao, M.J. | | Deposit date: | 2002-02-28 | | Release date: | 2002-09-12 | | Last modified: | 2011-09-21 | | Method: | X-RAY DIFFRACTION (1.42 Å) | | Cite: | Crystal Structure of a Prostate Kallikrein Isolated from Stallion Seminal Plasma: A Homologue of Human Psa
J.Mol.Biol., 322, 2002
|
|
5AHJ
 | | Yeast 20S proteasome in complex with Macyranone A | | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, 20S PROTEASOME, CHLORIDE ION, ... | | Authors: | Etzbach, L, Plaza, A, Dubiella, C, Groll, M, Kaiser, M, Mueller, R. | | Deposit date: | 2015-02-06 | | Release date: | 2015-02-18 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Macyranones: Structure, Biosynthesis, and Binding Mode of an Unprecedented Epoxyketone that Targets the 20S Proteasome.
J.Am.Chem.Soc., 137, 2015
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FQ3
 | | CRYSTAL STRUCTURE OF HUMAN GRANZYME B | | Descriptor: | GRANZYME B, SULFATE ION, beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose | | Authors: | Estebanez-Perpina, E, Fuentes-Prior, P, Belorgey, D, Rubin, H, Bode, W. | | Deposit date: | 2000-09-03 | | Release date: | 2001-01-31 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Crystal structure of the caspase activator human granzyme B, a proteinase highly specific for an Asp-P1 residue.
Biol.Chem., 381, 2000
|
|
2FP3
 | |
1JPF
 | | Crystal Structure Of The LCMV Peptidic Epitope Gp276 In Complex With The Murine Class I Mhc Molecule H-2Db | | Descriptor: | BETA-2-MICROGLOBULIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, D-B ALPHA CHAIN, ... | | Authors: | Ciatto, C, Tissot, A.C, Tschopp, M, Capitani, G, Pecorari, F, Pluckthun, A, Grutter, M.G. | | Deposit date: | 2001-08-02 | | Release date: | 2001-10-24 | | Last modified: | 2022-12-21 | | Method: | X-RAY DIFFRACTION (2.18 Å) | | Cite: | Zooming in on the hydrophobic ridge of H-2D(b): implications for the conformational variability of bound peptides.
J.Mol.Biol., 312, 2001
|
|
1MXO
 | | AmpC beta-lactamase in complex with an m.carboxyphenylglycylboronic acid bearing the cephalothin R1 side chain | | Descriptor: | (1R)-1-(2-THIENYLACETYLAMINO)-1-(3-CARBOXYPHENYL)METHYLBORONIC ACID, Beta-lactamase, PHOSPHATE ION | | Authors: | Morandi, F, Caselli, E, Morandi, S, Focia, P.J, Blazquez, J, Shoichet, B.K, Prati, F. | | Deposit date: | 2002-10-02 | | Release date: | 2003-03-04 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.83 Å) | | Cite: | Nanomolar inhibitors of AmpC beta-lactamase.
J.Am.Chem.Soc., 125, 2003
|
|
1MY8
 | | AmpC beta-lactamase in complex with an M.carboxyphenylglycylboronic acid bearing the cephalothin R1 side chain | | Descriptor: | (1R)-1-(2-THIENYLACETYLAMINO)-1-PHENYLMETHYLBORONIC ACID, PHOSPHATE ION, beta-lactamase | | Authors: | Morandi, F, Caselli, E, Morandi, S, Focia, P.J, Blazquez, J, Shoichet, B.K, Prati, F. | | Deposit date: | 2002-10-03 | | Release date: | 2003-03-04 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.72 Å) | | Cite: | Nanomolar inhibitors of AmpC beta-lactamase.
J.Am.Chem.Soc., 125, 2003
|
|
1JPG
 | | Crystal Structure Of The LCMV Peptidic Epitope Np396 In Complex With The Murine Class I Mhc Molecule H-2Db | | Descriptor: | BETA-2-MICROGLOBULIN, H-2 CLASS I HISTOCOMPATIBILITY ANTIGEN, D-B ALPHA CHAIN, ... | | Authors: | Ciatto, C, Tissot, A.C, Tschopp, M, Capitani, G, Pecorari, F, Pluckthun, A, Grutter, M.G. | | Deposit date: | 2001-08-02 | | Release date: | 2001-10-24 | | Last modified: | 2022-12-21 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Zooming in on the hydrophobic ridge of H-2D(b): implications for the conformational variability of bound peptides.
J.Mol.Biol., 312, 2001
|
|
4JQV
 | | HLA-B*18:01 in complex with Epstein-Barr virus BZLF1-derived peptide (residues 173-180) | | Descriptor: | ACETATE ION, Beta-2-microglobulin, HLA class I histocompatibility antigen, ... | | Authors: | Theodossis, A, Welland, A, Gras, S, Rossjohn, J. | | Deposit date: | 2013-03-20 | | Release date: | 2013-06-26 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | HLA Peptide Length Preferences Control CD8+ T Cell Responses.
J.Immunol., 191, 2013
|
|
1LMW
 | | LMW U-PA Structure complexed with EGRCMK (GLU-GLY-ARG Chloromethyl Ketone) | | Descriptor: | L-alpha-glutamyl-N-{(1S)-4-{[amino(iminio)methyl]amino}-1-[(1S)-2-chloro-1-hydroxyethyl]butyl}glycinamide, UROKINASE-TYPE PLASMINOGEN ACTIVATOR | | Authors: | Spraggon, G.S, Phillips, C, Nowak, U.K, Ponting, C.P, Saunders, D, Dobson, C.M, Stuart, D.I, Jones, E.Y. | | Deposit date: | 1995-07-26 | | Release date: | 1996-01-29 | | Last modified: | 2013-02-27 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | The crystal structure of the catalytic domain of human urokinase-type plasminogen activator.
Structure, 3, 1995
|
|
1KWM
 | | Human procarboxypeptidase B: Three-dimensional structure and implications for thrombin-activatable fibrinolysis inhibitor (TAFI) | | Descriptor: | CITRIC ACID, Procarboxypeptidase B, ZINC ION | | Authors: | Pereira, P.J.B, Segura-Martin, S, Ferrer-Orta, C, Vendrell, J, Aviles, F.-X, Coll, M, Gomis-Rueth, F.-X. | | Deposit date: | 2002-01-30 | | Release date: | 2002-06-05 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Human procarboxypeptidase B: three-dimensional structure and implications for thrombin-activatable fibrinolysis inhibitor (TAFI).
J.Mol.Biol., 321, 2002
|
|
4G42
 | | Structure of the Chicken MHC Class I Molecule BF2*0401 complexed to pepitde P8D | | Descriptor: | 8-MERIC PEPTIDE P8D, Beta-2 microglobulin, MHC class I alpha chain 2 | | Authors: | Zhang, J, Chen, Y, Qi, J, Gao, F, Liu, J, Kaufman, J, Xia, C, Gao, G.F. | | Deposit date: | 2012-07-16 | | Release date: | 2012-11-21 | | Method: | X-RAY DIFFRACTION (2.294 Å) | | Cite: | Narrow Groove and Restricted Anchors of MHC Class I Molecule BF2*0401 Plus Peptide Transporter Restriction Can Explain Disease Susceptibility of B4 Chickens.
J.Immunol., 189, 2012
|
|
1ESD
 | | THE MOLECULAR MECHANISM OF ENANTIORECOGNITION BY ESTERASES | | Descriptor: | ESTERASE, METHYLPHOSPHONIC ACID ESTER GROUP | | Authors: | Wei, Y, Schottel, J.L, Derewenda, U, Swenson, L, Patkar, S, Derewenda, Z.S. | | Deposit date: | 1994-10-07 | | Release date: | 1995-10-15 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | A novel variant of the catalytic triad in the Streptomyces scabies esterase.
Nat.Struct.Biol., 2, 1995
|
|
1ESE
 | | THE MOLECULAR MECHANISM OF ENANTIORECOGNITION BY ESTERASES | | Descriptor: | DIETHYL PHOSPHONATE, ESTERASE | | Authors: | Wei, Y, Schottel, J.L, Derewenda, U, Swenson, L, Patkar, S, Derewenda, Z.S. | | Deposit date: | 1994-10-07 | | Release date: | 1995-10-15 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | A novel variant of the catalytic triad in the Streptomyces scabies esterase.
Nat.Struct.Biol., 2, 1995
|
|
4JQX
 | | HLA-B*44:03 in complex with Epstein-Barr virus BZLF1-derived peptide (residues 169-180) | | Descriptor: | ACETATE ION, Beta-2-microglobulin, GLYCEROL, ... | | Authors: | Theodossis, A, Welland, A, Gras, S, Rossjohn, J. | | Deposit date: | 2013-03-20 | | Release date: | 2013-06-26 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | HLA Peptide Length Preferences Control CD8+ T Cell Responses.
J.Immunol., 191, 2013
|
|
7SP1
 | | RNA-induced tau amyloid fibril | | Descriptor: | Isoform Tau-F of Microtubule-associated protein tau, RNA (5'-R(*AP*AP*AP*AP*AP*AP*AP*AP*AP*A)-3') | | Authors: | Abskharon, R, Sawaya, M.R, Boyer, D.R, Eisenberg, D.S. | | Deposit date: | 2021-11-02 | | Release date: | 2022-03-30 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Cryo-EM structure of RNA-induced tau fibrils reveals a small C-terminal core that may nucleate fibril formation.
Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
2C3S
 | | Structure Of Sars Cov Main Proteinase At 1.9 A (Ph6.5) | | Descriptor: | SARS COV 3C-LIKE PROTEINASE | | Authors: | Xu, T, Ooi, A, Lee, H.-C, Lescar, J. | | Deposit date: | 2005-10-12 | | Release date: | 2005-10-18 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structure of the Sars Coronavirus Main Proteinase as an Active C2 Crystallographic Dimer.
Acta Crystallogr.,Sect.F, 61, 2005
|
|
2BX3
 | |
2BX4
 | |
