5L8Z
| Structure of thermostable DNA-binding HU protein from micoplasma Spiroplasma melliferum | Descriptor: | DNA-binding protein, SODIUM ION | Authors: | Boyko, K.M, Gorbacheva, M.A, Rakitina, T.V, Korzhenevskiy, D.A, Kamashev, D.E, Vanyushkina, A.A, Lipkin, A.V, Popov, V.O. | Deposit date: | 2016-06-09 | Release date: | 2016-06-22 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Structural basis of the high thermal stability of the histone-like HU protein from the mollicute Spiroplasma melliferum KC3. Sci Rep, 6, 2016
|
|
8S92
| |
7W9V
| Cryo-EM structure of nucleosome in complex with p300 acetyltransferase catalytic core (complex I) | Descriptor: | DNA (145-MER), Histone H2A type 1-B/E, Histone H2B type 1-J, ... | Authors: | Hatazawa, S, Liu, J, Takizawa, Y, Zandian, M, Negishi, L, Kutateladze, T.G, Kurumizaka, H. | Deposit date: | 2021-12-10 | Release date: | 2022-07-13 | Method: | ELECTRON MICROSCOPY (3.95 Å) | Cite: | Structural basis for binding diversity of acetyltransferase p300 to the nucleosome. Iscience, 25, 2022
|
|
150D
| GUANINE.1,N6-ETHENOADENINE BASE-PAIRS IN THE CRYSTAL STRUCTURE OF D(CGCGAATT(EDA)GCG) | Descriptor: | DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*(EDA)P*GP*CP*G)-3'), MAGNESIUM ION | Authors: | Leonard, G.A, McAuley-Hecht, K.E, Gibson, N.J, Brown, T, Watson, W.P, Hunter, W.N. | Deposit date: | 1993-12-02 | Release date: | 1994-05-31 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Guanine-1,N6-ethenoadenine base pairs in the crystal structure of d(CGCGAATT(epsilon dA)GCG). Biochemistry, 33, 1994
|
|
2IX2
| Crystal structure of the heterotrimeric PCNA from Sulfolobus solfataricus | Descriptor: | DNA POLYMERASE SLIDING CLAMP A, DNA POLYMERASE SLIDING CLAMP B, DNA POLYMERASE SLIDING CLAMP C | Authors: | Williams, G.J, Johnson, K, McMahon, S.A, Carter, L, Oke, M, Liu, H, Taylor, G.L, White, M.F, Naismith, J.H. | Deposit date: | 2006-07-05 | Release date: | 2006-10-04 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structure of the Heterotrimeric PCNA from Sulfolobus Solfataricus. Acta Crystallogr.,Sect.F, 62, 2006
|
|
8VFY
| |
153D
| CRYSTAL STRUCTURE OF A MISPAIRED DODECAMER, D(CGAGAATTC(O6ME)GCG)2, CONTAINING A CARCINOGENIC O6-METHYLGUANINE | Descriptor: | DNA (5'-D(*CP*GP*AP*GP*AP*AP*TP*TP*CP*(6OG)P*CP*G)-3') | Authors: | Ginell, S.L, Vojtechovsky, J, Gaffney, B, Jones, R, Berman, H.M. | Deposit date: | 1993-12-16 | Release date: | 1994-01-15 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structure of a mispaired dodecamer, d(CGAGAATTC(O6Me)GCG)2, containing a carcinogenic O6-methylguanine Biochemistry, 33, 1994
|
|
2E9X
| The crystal structure of human GINS core complex | Descriptor: | DNA replication complex GINS protein PSF1, DNA replication complex GINS protein PSF2, GINS complex subunit 3, ... | Authors: | Kamada, K, Hanaoka, F. | Deposit date: | 2007-01-27 | Release date: | 2007-04-10 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structure of the human GINS complex and its assembly and functional interface in replication initiation Nat.Struct.Mol.Biol., 14, 2007
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
5IP3
| Tomato spotted wilt tospovirus nucleocapsid protein-ssDNA complex | Descriptor: | DNA (5'-D(P*TP*TP*TP*TP*T)-3'), DNA (5'-D(P*TP*TP*TP*TP*TP*T)-3'), DNA (5'-D(P*TP*TP*TP*TP*TP*TP*T)-3'), ... | Authors: | Komoda, K, Narita, M, Yamashita, K, Tanaka, I, Yao, M. | Deposit date: | 2016-03-09 | Release date: | 2017-03-22 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Asymmetric Trimeric Ring Structure of the Nucleocapsid Protein of Tospovirus. J. Virol., 91, 2017
|
|
8G3G
| CryoEM structure of yeast recombination mediator Rad52 | Descriptor: | DNA repair and recombination protein RAD52 | Authors: | Deveryshetty, J, Basore, K, Rau, M, Fitzpatrick, J.A.J, Antony, E. | Deposit date: | 2023-02-07 | Release date: | 2023-11-15 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Yeast Rad52 is a homodecamer and possesses BRCA2-like bipartite Rad51 binding modes. Nat Commun, 14, 2023
|
|
5YBB
| Structural basis underlying complex assembly andconformational transition of the type I R-M system | Descriptor: | DNA, Restriction endonuclease S subunits, S-ADENOSYLMETHIONINE, ... | Authors: | Liu, Y.P, Tang, Q, Zhang, J.Z, Tian, L.F, Gao, P, Yan, X.X. | Deposit date: | 2017-09-04 | Release date: | 2017-11-29 | Last modified: | 2018-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Structural basis underlying complex assembly and conformational transition of the type I R-M system. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
6ZHX
| Cryo-EM structure of the regulatory linker of ALC1 bound to the nucleosome's acidic patch: nucleosome class. | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (145-MER) Widom 601 sequence, Histone H2A type 1, ... | Authors: | Bacic, L, Gaullier, G, Croll, T.I, Deindl, S. | Deposit date: | 2020-06-24 | Release date: | 2020-12-23 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (2.5 Å) | Cite: | Mechanistic Insights into Regulation of the ALC1 Remodeler by the Nucleosome Acidic Patch. Cell Rep, 33, 2020
|
|
6ZHY
| Cryo-EM structure of the regulatory linker of ALC1 bound to the nucleosome's acidic patch: hexasome class. | Descriptor: | Chromodomain-helicase-DNA-binding protein 1-like, DNA (110-MER) Widom 601 sequence, Histone H2A type 1, ... | Authors: | Bacic, L, Gaullier, G, Deindl, S. | Deposit date: | 2020-06-24 | Release date: | 2020-12-23 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Mechanistic Insights into Regulation of the ALC1 Remodeler by the Nucleosome Acidic Patch. Cell Rep, 33, 2020
|
|
8HR5
| Cryo-EM structure of the CnCas12f1-sgRNA-DNA complex | Descriptor: | DNA (28-MER), DNA (5'-D(*TP*AP*AP*CP*CP*TP*AP*AP*TP*AP*GP*AP*TP*GP*TP*GP*AP*A)-3'), Transposase, ... | Authors: | Li, F, Ji, Q. | Deposit date: | 2022-12-14 | Release date: | 2023-09-06 | Method: | ELECTRON MICROSCOPY (3.73 Å) | Cite: | Structure and engineering of miniature Clostridium novyi CRISPR-Cas12f1 with rare C-rich PAM specificity To Be Published
|
|
7BGF
| |
7U0J
| Structure of 162bp LIN28b nucleosome | Descriptor: | DNA (162-MER), Histone H2A type 2-C, Histone H2B type 2-E, ... | Authors: | Lian, T, Guan, R, Bai, Y. | Deposit date: | 2022-02-18 | Release date: | 2023-06-28 | Method: | ELECTRON MICROSCOPY (2.7 Å) | Cite: | Structural mechanism of LIN28B nucleosome targeting by OCT4. Mol.Cell, 83, 2023
|
|
7X1N
| Crystal structure of MEF2D-MRE complex | Descriptor: | DNA (5'-D(P*AP*AP*CP*TP*AP*TP*TP*TP*AP*TP*AP*AP*G)-3'), DNA (5'-D(P*TP*CP*TP*TP*AP*TP*AP*AP*AP*TP*AP*GP*T)-3'), Myocyte enhancer factor 2D/deleted in azoospermia associated protein 1 fusion protein | Authors: | Zhang, H, Zhang, M, Wang, Q.Q, Chen, Z, Chen, S.J, Meng, G. | Deposit date: | 2022-02-24 | Release date: | 2022-05-25 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.315 Å) | Cite: | Functional, structural, and molecular characterizations of the leukemogenic driver MEF2D-HNRNPUL1 fusion. Blood, 140, 2022
|
|
6HVO
| Crystal structure of human PCNA in complex with three peptides of p12 subunit of human polymerase delta | Descriptor: | DNA polymerase delta subunit 4, Proliferating cell nuclear antigen, SULFATE ION | Authors: | Gonzalez-Magana, A, Romano-Moreno, M, Rojas, A.L, Blanco, F.J, De Biasio, A. | Deposit date: | 2018-10-11 | Release date: | 2019-01-23 | Last modified: | 2019-03-27 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | The p12 subunit of human polymerase delta uses an atypical PIP box for molecular recognition of proliferating cell nuclear antigen (PCNA). J.Biol.Chem., 294, 2019
|
|
2A6H
| Crystal structure of the T. thermophilus RNA polymerase holoenzyme in complex with antibiotic sterptolydigin | Descriptor: | DNA-directed RNA polymerase alpha chain, DNA-directed RNA polymerase beta chain, DNA-directed RNA polymerase beta' chain, ... | Authors: | Temiakov, D, Zenkin, N, Vassylyeva, M.N, Perederina, A, Tahirov, T.H, Savkina, M, Zorov, S, Nikiforov, V, Igarashi, N, Matsugaki, N, Wakatsuki, S, Severinov, K, Vassylyev, D.G, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2005-07-02 | Release date: | 2005-09-20 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural basis of transcription inhibition by antibiotic streptolydigin. Mol.Cell, 19, 2005
|
|
8GMU
| Structure of lambda repressor in complex with RecA filament | Descriptor: | DNA (5'-D(P*TP*TP*TP*TP*TP*T)-3'), MAGNESIUM ION, PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER, ... | Authors: | Gao, B, Feng, Y. | Deposit date: | 2022-08-22 | Release date: | 2022-12-21 | Last modified: | 2024-07-03 | Method: | ELECTRON MICROSCOPY (2.78 Å) | Cite: | Structural basis for regulation of SOS response in bacteria. Proc.Natl.Acad.Sci.USA, 120, 2023
|
|
8E2P
| |
8E2Q
| Crystal structure of TadAC-1.17 in a complex with ssDNA | Descriptor: | DNA (5'-D(P*GP*CP*GP*GP*CP*TP*(D8A)P*CP*GP*GP*A)-3'), GLYCEROL, ZINC ION, ... | Authors: | Feliciano, P.R, Lee, S.J, Ciaramella, G. | Deposit date: | 2022-08-15 | Release date: | 2023-01-11 | Last modified: | 2023-10-25 | Method: | X-RAY DIFFRACTION (2.34 Å) | Cite: | Improved cytosine base editors generated from TadA variants. Nat.Biotechnol., 41, 2023
|
|
5GVA
| WD40 domain of human AND-1 | Descriptor: | WD repeat and HMG-box DNA-binding protein 1 | Authors: | Guan, C.C, Li, J. | Deposit date: | 2016-09-04 | Release date: | 2017-04-19 | Last modified: | 2024-10-09 | Method: | X-RAY DIFFRACTION (1.851 Å) | Cite: | The structure and polymerase-recognition mechanism of the crucial adaptor protein AND-1 in the human replisome J. Biol. Chem., 292, 2017
|
|
5GVB
| SepB domain of human AND-1 | Descriptor: | WD repeat and HMG-box DNA-binding protein 1 | Authors: | Guan, C.C, Li, J. | Deposit date: | 2016-09-05 | Release date: | 2017-04-19 | Last modified: | 2017-06-21 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | The structure and polymerase-recognition mechanism of the crucial adaptor protein AND-1 in the human replisome. J. Biol. Chem., 292, 2017
|
|