7YYH
| Structure of the human CCANdeltaT CENP-A alpha-satellite complex | Descriptor: | Centromere protein C, Centromere protein H, Centromere protein I, ... | Authors: | Yatskevich, S, Muir, K.W, Bellini, D, Zhang, Z, Yang, J, Tischer, T, Predin, M, Dendooven, T, McLaughlin, S.H, Barford, D. | Deposit date: | 2022-02-17 | Release date: | 2022-05-18 | Last modified: | 2022-06-01 | Method: | ELECTRON MICROSCOPY (8.9 Å) | Cite: | Structure of the human inner kinetochore bound to a centromeric CENP-A nucleosome. Science, 376, 2022
|
|
7YWX
| Structure of the human CCAN CENP-A alpha-satellite complex | Descriptor: | Centromere protein C, Centromere protein H, Centromere protein I, ... | Authors: | Yatskevich, S, Muir, K.W, Bellini, D, Zhang, Z, Yang, J, Tischer, T, Predin, M, Dendooven, T, McLaughlin, S.H, Barford, D. | Deposit date: | 2022-02-14 | Release date: | 2022-05-18 | Last modified: | 2022-06-01 | Method: | ELECTRON MICROSCOPY (12 Å) | Cite: | Structure of the human inner kinetochore bound to a centromeric CENP-A nucleosome. Science, 376, 2022
|
|
5MLU
| Crystal structure of the PFV GAG CBS bound to a mononucleosome | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B, ... | Authors: | Pye, V.E, Maskell, D.P, Lesbats, P, Cherepanov, P. | Deposit date: | 2016-12-07 | Release date: | 2017-05-10 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structural basis for spumavirus GAG tethering to chromatin. Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
7YOZ
| Cryo-EM structure of human subnucleosome (intermediate form) | Descriptor: | Histone H3.1, Histone H4, Widom601 DNA FW (145-MER), ... | Authors: | Nozawa, K, Takizawa, Y, Kurumizaka, H. | Deposit date: | 2022-08-02 | Release date: | 2022-11-16 | Method: | ELECTRON MICROSCOPY (4.3 Å) | Cite: | Cryo-electron microscopy structure of the H3-H4 octasome: A nucleosome-like particle without histones H2A and H2B. Proc.Natl.Acad.Sci.USA, 119, 2022
|
|
3REK
| |
3REH
| |
5NL0
| Crystal structure of a 197-bp palindromic 601L nucleosome in complex with linker histone H1 | Descriptor: | DNA (197-MER), Histone H1.0-B, Histone H2A type 1, ... | Authors: | Garcia-Saez, I, Petosa, C, Dimitrov, S. | Deposit date: | 2017-04-03 | Release date: | 2017-05-17 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (5.4 Å) | Cite: | Structure and Dynamics of a 197 bp Nucleosome in Complex with Linker Histone H1. Mol. Cell, 66, 2017
|
|
5O9G
| Structure of nucleosome-Chd1 complex | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, BERYLLIUM TRIFLUORIDE ION, Chromo domain-containing protein 1, ... | Authors: | Farnung, L, Vos, S.M, Wigge, C, Cramer, P. | Deposit date: | 2017-06-19 | Release date: | 2017-10-11 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (4.8 Å) | Cite: | Nucleosome-Chd1 structure and implications for chromatin remodelling. Nature, 550, 2017
|
|
3R45
| Structure of a CENP-A-Histone H4 Heterodimer in complex with chaperone HJURP | Descriptor: | GLYCEROL, Histone H3-like centromeric protein A, Histone H4, ... | Authors: | Hu, H, Liu, Y, Wang, M, Fang, J, Huang, H, Yang, N, Li, Y, Wang, J, Yao, X, Shi, Y, Li, G, Xu, R.M. | Deposit date: | 2011-03-17 | Release date: | 2011-04-06 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structure of a CENP-A-histone H4 heterodimer in complex with chaperone HJURP Genes Dev., 25, 2011
|
|
5OMX
| |
5OXV
| Structure of the 4_601_157 tetranucleosome (C2 form) | Descriptor: | DNA STRAND 1 (601-based sequence model), DNA STRAND 2 (601-based sequence model), Histone H2A, ... | Authors: | Ekundayo, B, Schalch, T. | Deposit date: | 2017-09-07 | Release date: | 2017-10-11 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (6.721 Å) | Cite: | Capturing Structural Heterogeneity in Chromatin Fibers. J. Mol. Biol., 429, 2017
|
|
5ONG
| X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | Deposit date: | 2017-08-03 | Release date: | 2017-11-22 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.797 Å) | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability. J. Mol. Biol., 430, 2018
|
|
3REI
| |
3REJ
| |
3REL
| |
7PII
| Structure of the human CCAN CENP-A alpha-satellite complex | Descriptor: | Centromere protein C, DNA (122-MER), DNA (123-MER), ... | Authors: | Yatskevich, S, Muir, K.W, Bellini, D, Barford, D. | Deposit date: | 2021-08-19 | Release date: | 2022-05-25 | Last modified: | 2022-06-01 | Method: | ELECTRON MICROSCOPY (2.68 Å) | Cite: | Structure of the human inner kinetochore bound to a centromeric CENP-A nucleosome. Science, 376, 2022
|
|
7R5R
| Structure of the human CCAN CENP-A alpha-satellite complex | Descriptor: | Centromere protein C, DNA (171-MER), Histone H2A type 1-C, ... | Authors: | Yatskevich, S, Muir, K.W, Bellini, D, Zhang, Z, Yang, J, Tischer, T, Predin, M, Dendooven, T, McLaughlin, S.H, Barford, D. | Deposit date: | 2022-02-11 | Release date: | 2022-04-27 | Last modified: | 2022-06-01 | Method: | ELECTRON MICROSCOPY (2.44 Å) | Cite: | Structure of the human inner kinetochore bound to a centromeric CENP-A nucleosome. Science, 376, 2022
|
|
7SCY
| Nuc147 bound to single BRCT | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B type 1-J, ... | Authors: | Muthurajan, U.M, Rudolph, J.R. | Deposit date: | 2021-09-29 | Release date: | 2022-01-12 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (4.1 Å) | Cite: | The BRCT domain of PARP1 binds intact DNA and mediates intrastrand transfer. Mol.Cell, 81, 2021
|
|
7SCZ
| Nuc147 bound to multiple BRCTs | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B type 1-J, ... | Authors: | Muthurajan, U.M, Rudolph, J. | Deposit date: | 2021-09-29 | Release date: | 2022-01-19 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | The BRCT domain of PARP1 binds intact DNA and mediates intrastrand transfer. Mol.Cell, 81, 2021
|
|
1HIO
| HISTONE OCTAMER (CHICKEN), CHROMOSOMAL PROTEIN, ALPHA CARBONS ONLY | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | Authors: | Arents, G, Moudrianakis, E.N. | Deposit date: | 1991-09-19 | Release date: | 1998-11-25 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix. Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1ID3
| CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS | Descriptor: | HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ... | Authors: | White, C.L, Suto, R.K, Luger, K. | Deposit date: | 2001-04-03 | Release date: | 2001-09-28 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions. EMBO J., 20, 2001
|
|
1M19
| LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
|
|