6BLE
 
 | | Crystal Structure of the Human CAMKK2B in complex with CP673451 | | Descriptor: | 1-{2-[5-(2-methoxyethoxy)-1H-benzimidazol-1-yl]quinolin-8-yl}piperidin-4-amine, Calcium/calmodulin-dependent protein kinase kinase 2, GLYCEROL | | Authors: | Counago, R.M, dos Reis, C.V, de Souza, G.P, Ramos, P.Z, Drewry, D, Massirer, K.B, Arruda, P, Edwards, A.M, Elkins, J.M, Structural Genomics Consortium (SGC) | | Deposit date: | 2017-11-10 | | Release date: | 2017-11-29 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Crystal Structure of the Human CAMKK2B in complex with CP673451
To Be Published
|
|
7F1E
 | | Structure of METTL6 bound with SAM | | Descriptor: | S-ADENOSYLMETHIONINE, tRNA N(3)-methylcytidine methyltransferase METTL6 | | Authors: | Li, S, Liao, S, Xu, C. | | Deposit date: | 2021-06-09 | | Release date: | 2022-01-12 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.589 Å) | | Cite: | Structural basis for METTL6-mediated m3C RNA methylation.
Biochem.Biophys.Res.Commun., 589, 2021
|
|
7C17
 | |
6HVI
 | | Human PFKFB3 in complex with a N-Aryl 6-Aminoquinoxaline inhibitor 2 | | Descriptor: | 6-O-phosphono-beta-D-fructofuranose, 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3, 8-[3-(dimethylamino)phenyl]-~{N}-(4-methylsulfonylpyridin-3-yl)quinoxalin-6-amine, ... | | Authors: | Banaszak, K, Sowinska, M, Gondela, A, Fabritius, C.H, Nowak, M. | | Deposit date: | 2018-10-11 | | Release date: | 2018-11-14 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.96 Å) | | Cite: | Discovery and Structure-Activity Relationships of N-Aryl 6-Aminoquinoxalines as Potent PFKFB3 Kinase Inhibitors.
ChemMedChem, 14, 2019
|
|
7BT2
 | | Crystal structure of the SERCA2a in the E2.ATP state | | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, ADENOSINE-5'-TRIPHOSPHATE, ... | | Authors: | Kabashima, Y, Ogawa, H, Nakajima, R, Toyoshima, C. | | Deposit date: | 2020-03-31 | | Release date: | 2020-07-15 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (3.00002861 Å) | | Cite: | What ATP binding does to the Ca2+pump and how nonproductive phosphoryl transfer is prevented in the absence of Ca2.
Proc.Natl.Acad.Sci.USA, 117, 2020
|
|
7ER6
 | | Crystal structure of human Biliverdin IX-beta reductase B | | Descriptor: | Flavin reductase (NADPH), NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, SULFATE ION | | Authors: | Griesinger, C, Lee, D, Ryu, K.S, Kim, M, Ha, J.H. | | Deposit date: | 2021-05-06 | | Release date: | 2022-01-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Repositioning Food and Drug Administration-Approved Drugs for Inhibiting Biliverdin IX beta Reductase B as a Novel Thrombocytopenia Therapeutic Target.
J.Med.Chem., 65, 2022
|
|
7ER7
 | | Crystal structure of hyman Biliverdin IX-beta reductase B with Tamibarotene (A80) | | Descriptor: | 4-[(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)carbamoyl]benzoic acid, Flavin reductase (NADPH), NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | | Authors: | Griesinger, C, Lee, D, Ryu, K.S, Kim, M, Ha, J.H. | | Deposit date: | 2021-05-06 | | Release date: | 2022-01-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Repositioning Food and Drug Administration-Approved Drugs for Inhibiting Biliverdin IX beta Reductase B as a Novel Thrombocytopenia Therapeutic Target.
J.Med.Chem., 65, 2022
|
|
7ERD
 | | Crystal structure of human Biliverdin IX-beta reductase B with Flunixin Meglumin (FMG) | | Descriptor: | 2-[[2-methyl-3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid, Flavin reductase (NADPH), NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | | Authors: | Griesinger, C, Lee, D, Ryu, K.S, Kim, M, Ha, J.H. | | Deposit date: | 2021-05-06 | | Release date: | 2022-01-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Repositioning Food and Drug Administration-Approved Drugs for Inhibiting Biliverdin IX beta Reductase B as a Novel Thrombocytopenia Therapeutic Target.
J.Med.Chem., 65, 2022
|
|
7ER8
 | | Crystal structure of human Biliverdin IX-beta reductase B with Sulfasalazine (SAS) | | Descriptor: | 2-HYDROXY-(5-([4-(2-PYRIDINYLAMINO)SULFONYL]PHENYL)AZO)BENZOIC ACID, Flavin reductase (NADPH), NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | | Authors: | Griesinger, C, Lee, D, Ryu, K.S, Kim, M, Ha, J.H. | | Deposit date: | 2021-05-06 | | Release date: | 2022-01-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | Repositioning Food and Drug Administration-Approved Drugs for Inhibiting Biliverdin IX beta Reductase B as a Novel Thrombocytopenia Therapeutic Target.
J.Med.Chem., 65, 2022
|
|
7F8R
 | |
7ERC
 | | Crystal structure of human Biliverdin IX-beta reductase B with Deferasirox (ICL) | | Descriptor: | 4-[3,5-bis(2-hydroxyphenyl)-1,2,4-triazol-1-yl]benzoic acid, Flavin reductase (NADPH), NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | | Authors: | Griesinger, C, Lee, D, Ryu, K.S, Kim, M, Ha, J.H. | | Deposit date: | 2021-05-06 | | Release date: | 2022-01-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Repositioning Food and Drug Administration-Approved Drugs for Inhibiting Biliverdin IX beta Reductase B as a Novel Thrombocytopenia Therapeutic Target.
J.Med.Chem., 65, 2022
|
|
8TJN
 | | Crosslinked 6-deoxyerythronolide B synthase (DEBS) Module 1 in complex with antibody fragment 1B2: Crosslinked State 1 | | Descriptor: | Antibody Fragment 1B2, Heavy Chain, Light Chain, ... | | Authors: | Cogan, D.P, Soohoo, A.M, Chen, M, Brodsky, K.L, Liu, Y, Khosla, C. | | Deposit date: | 2023-07-23 | | Release date: | 2024-07-24 | | Last modified: | 2024-09-04 | | Method: | ELECTRON MICROSCOPY (3.73 Å) | | Cite: | Structural basis for intermodular communication in assembly-line polyketide biosynthesis.
Nat.Chem.Biol., 2024
|
|
6W8K
 | | Co-crystal structures of CHIKV nsP3 macrodomain with pyrimidone fragments | | Descriptor: | 5,6-dimethyl-2-oxo-2,3-dihydropyrimidine-4-carboxylic acid, Nonstructural polyprotein | | Authors: | Zhang, S, Garzan, A, Augelli-Szafran, C.E, Pathak, A.K, Wu, M. | | Deposit date: | 2020-03-20 | | Release date: | 2021-01-13 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Pyrimidone inhibitors targeting Chikungunya Virus nsP3 macrodomain by fragment-based drug design.
Plos One, 16, 2021
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
6W8U
 | | Cryo-EM of the Pyrobaculum arsenaticum pilus | | Descriptor: | pilin | | Authors: | Wang, F, Baquero, D.P, Su, Z, Beltran, L.C, Prangishvili, D, Krupovic, M, Egelman, E.H. | | Deposit date: | 2020-03-21 | | Release date: | 2020-07-08 | | Last modified: | 2024-10-16 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | The structures of two archaeal type IV pili illuminate evolutionary relationships.
Nat Commun, 11, 2020
|
|
4RPP
 | | crystal structure of PKM2-K422R mutant bound with FBP | | Descriptor: | 1,6-di-O-phosphono-beta-D-fructofuranose, Pyruvate kinase PKM | | Authors: | Wang, P, Sun, C, Zhu, T, Xu, Y. | | Deposit date: | 2014-10-31 | | Release date: | 2015-02-25 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (2.585 Å) | | Cite: | Structural insight into mechanisms for dynamic regulation of PKM2.
Protein Cell, 6, 2015
|
|
7SIY
 | | cCBL TKB domain in complex with pZAP70 peptide | | Descriptor: | E3 ubiquitin-protein ligase CBL, MAGNESIUM ION, Peptide from Tyrosine-protein kinase ZAP-70 | | Authors: | Murray, J.M, Yu, C. | | Deposit date: | 2021-10-15 | | Release date: | 2022-11-09 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (1.48 Å) | | Cite: | cCBL TKB domain in complex with pZAP70 peptide
To Be Published
|
|
4RQK
 | |
7ERA
 | | Crystal structure of human Biliverdin IX-beta reductase B with Olsalazine Sodium (OSS) | | Descriptor: | 5-[(E)-(3-carboxy-4-oxidanyl-phenyl)diazenyl]-2-oxidanyl-benzoic acid, Flavin reductase (NADPH), NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | | Authors: | Griesinger, C, Lee, D, Ryu, K.S, Kim, M, Ha, J.H. | | Deposit date: | 2021-05-06 | | Release date: | 2022-01-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.35 Å) | | Cite: | Repositioning Food and Drug Administration-Approved Drugs for Inhibiting Biliverdin IX beta Reductase B as a Novel Thrombocytopenia Therapeutic Target.
J.Med.Chem., 65, 2022
|
|
6BQN
 | | Cryo-EM structure of ENaC | | Descriptor: | 10D4 fab, 7B1 fab, EGFP-SCNN1G chimera, ... | | Authors: | Noreng, S, Bharadwaj, A, Posert, R, Yoshioka, C, Baconguis, I. | | Deposit date: | 2017-11-28 | | Release date: | 2018-10-10 | | Last modified: | 2025-05-14 | | Method: | ELECTRON MICROSCOPY (3.9 Å) | | Cite: | Structure of the human epithelial sodium channel by cryo-electron microscopy.
Elife, 7, 2018
|
|
7QBA
 | | CryoEM structure of the ABC transporter NosDFY complexed with nitrous oxide reductase NosZ | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, CALCIUM ION, MAGNESIUM ION, ... | | Authors: | Zipfel, S, Mueller, C, Topitsch, A, Lutz, M, Zhang, L, Einsle, O. | | Deposit date: | 2021-11-18 | | Release date: | 2022-08-03 | | Last modified: | 2024-07-17 | | Method: | ELECTRON MICROSCOPY (3.78 Å) | | Cite: | Molecular interplay of an assembly machinery for nitrous oxide reductase.
Nature, 608, 2022
|
|
6HDM
 | | R49A variant of beta-phosphoglucomutase from Lactococcus lactis complexed with magnesium trifluoride and beta-G6P to 1.3 A. | | Descriptor: | 1,2-ETHANEDIOL, 1,3-PROPANDIOL, 6-O-phosphono-beta-D-glucopyranose, ... | | Authors: | Robertson, A.J, Bisson, C, Waltho, J.P. | | Deposit date: | 2018-08-17 | | Release date: | 2020-08-26 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Transition state of phospho-enzyme hydrolysis in beta-phosphoglucomutase.
To Be Published
|
|
6BTX
 | | Structure of a bacterial metal transporter | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, NICKEL (II) ION, ... | | Authors: | Jormakka, M, Deshpande, C.N. | | Deposit date: | 2017-12-08 | | Release date: | 2018-09-19 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Calcium is an essential cofactor for metal efflux by the ferroportin transporter family.
Nat Commun, 9, 2018
|
|
7SJ0
 | |
6HDJ
 | |
