7CE2
 
 | | The Crystal structure of TeNT Hc complexed with neutralizing antibody | | Descriptor: | Tetanus toxin, neutralizing antibody heavy chain, neutralizing antibody light chain | | Authors: | Wang, X, Wang, Y, Wu, C, Yu, J, Liao, H. | | Deposit date: | 2020-06-21 | | Release date: | 2021-04-07 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.01 Å) | | Cite: | Structural basis of tetanus toxin neutralization by native human monoclonal antibodies.
Cell Rep, 35, 2021
|
|
2M80
 | | Solution structure of yeast dithiol glutaredoxin Grx8 | | Descriptor: | Glutaredoxin-8 | | Authors: | Tang, Y, Zhang, J, Yu, J, Wu, J, Zhou, C.Z, Shi, Y. | | Deposit date: | 2013-05-02 | | Release date: | 2014-05-07 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structure-guided activity enhancement and catalytic mechanism of yeast grx8
Biochemistry, 53, 2014
|
|
6PT2
 | | Crystal structure of the active delta opioid receptor in complex with the peptide agonist KGCHM07 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHOLESTEROL, Delta opioid receptor, ... | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
6PT3
 | | Crystal structure of the active delta opioid receptor in complex with the small molecule agonist DPI-287 | | Descriptor: | 4-[(R)-[(2S,5R)-4-benzyl-2,5-dimethylpiperazin-1-yl](3-hydroxyphenyl)methyl]-N,N-diethylbenzamide, Delta opioid receptor | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
4DSR
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in reduced form | | Descriptor: | Peroxiredoxin type-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.91 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species.
J.Biol.Chem., 287, 2012
|
|
4DSQ
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in oxidized form | | Descriptor: | Peroxiredoxin type-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species
J.Biol.Chem., 287, 2012
|
|
4DSS
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in complex with thioredoxin Trx2 | | Descriptor: | Peroxiredoxin type-2, Thioredoxin-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species.
J.Biol.Chem., 287, 2012
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1ROQ
 | |
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1TXS
 | | STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | | Descriptor: | Enteroviral 5'-UTR | | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | | Deposit date: | 2004-07-06 | | Release date: | 2004-10-05 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses
Biochemistry, 43, 2004
|
|
6DW0
 | | Cryo-EM structure of the benzodiazepine-sensitive alpha1beta1gamma2S tri-heteromeric GABAA receptor in complex with GABA (Whole map) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, GAMMA-AMINO-BUTANOIC ACID, Gamma-aminobutyric acid receptor subunit alpha-1,Gamma-aminobutyric acid receptor subunit alpha-1, ... | | Authors: | Phulera, S, Zhu, H, Yu, J, Yoshioka, C, Gouaux, E. | | Deposit date: | 2018-06-26 | | Release date: | 2018-08-08 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Cryo-EM structure of the benzodiazepine-sensitive alpha 1 beta 1 gamma 2S tri-heteromeric GABAAreceptor in complex with GABA.
Elife, 7, 2018
|
|
6DW1
 | | Cryo-EM structure of the benzodiazepine-sensitive alpha1beta1gamma2S tri-heteromeric GABAA receptor in complex with GABA (ECD map) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, GAMMA-AMINO-BUTANOIC ACID, Gamma-aminobutyric acid receptor subunit alpha-1,Gamma-aminobutyric acid receptor subunit alpha-1, ... | | Authors: | Phulera, S, Zhu, H, Yu, J, Yoshioka, C, Gouaux, E. | | Deposit date: | 2018-06-26 | | Release date: | 2018-08-08 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (3.1 Å) | | Cite: | Cryo-EM structure of the benzodiazepine-sensitive alpha 1 beta 1 gamma 2S tri-heteromeric GABAAreceptor in complex with GABA.
Elife, 7, 2018
|
|
6M0J
 | | Crystal structure of SARS-CoV-2 spike receptor-binding domain bound with ACE2 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Angiotensin-converting enzyme 2, CHLORIDE ION, ... | | Authors: | Wang, X, Lan, J, Ge, J, Yu, J, Shan, S. | | Deposit date: | 2020-02-21 | | Release date: | 2020-03-18 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.
Nature, 581, 2020
|
|
5ZUE
 | | GTP-bound, double-stranded, curved FtsZ protofilament structure | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-TRIPHOSPHATE | | Authors: | Guan, F, Yu, J, Yu, J, Liu, Y, Li, Y, Feng, X.H, Huang, K.C, Chang, Z, Ye, S. | | Deposit date: | 2018-05-07 | | Release date: | 2018-07-04 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Lateral interactions between protofilaments of the bacterial tubulin homolog FtsZ are essential for cell division
Elife, 7, 2018
|
|
3CMI
 | |
3D8X
 | | Crystal Structure of Saccharomyces cerevisiae NDPPH Dependent Thioredoxin Reductase 1 | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, Thioredoxin reductase 1 | | Authors: | Zhang, Z.Y, Bao, R, Yu, J, Chen, Y.X, Zhou, C.-Z. | | Deposit date: | 2008-05-26 | | Release date: | 2008-12-09 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of Saccharomyces cerevisiae cytoplasmic thioredoxin reductase Trr1 reveals the structural basis for species-specific recognition of thioredoxin
Biochim.Biophys.Acta, 1794, 2009
|
|
3G60
 | | Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding | | Descriptor: | (4R,11R,18R)-4,11,18-tri(propan-2-yl)-6,13,20-triselena-3,10,17,22,23,24-hexaazatetracyclo[17.2.1.1~5,8~.1~12,15~]tetracosa-1(21),5(24),7,12(23),14,19(22)-hexaene-2,9,16-trione, Multidrug resistance protein 1a | | Authors: | Aller, S.G, Yu, J, Ward, A, Weng, Y, Chittaboina, S, Zhuo, R, Harrell, P.M, Trinh, Y.T, Zhang, Q, Urbatsch, I.L, Chang, G. | | Deposit date: | 2009-02-05 | | Release date: | 2009-03-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.4 Å) | | Cite: | Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding.
Science, 323, 2009
|
|
3G5U
 | | Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding | | Descriptor: | MERCURY (II) ION, Multidrug resistance protein 1a | | Authors: | Aller, S.G, Yu, J, Ward, A, Weng, Y, Chittaboina, S, Zhuo, R, Harrell, P.M, Trinh, Y.T, Zhang, Q, Urbatsch, I.L, Chang, G. | | Deposit date: | 2009-02-05 | | Release date: | 2009-03-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.8 Å) | | Cite: | Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding.
Science, 323, 2009
|
|
3G61
 | | Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding | | Descriptor: | (4S,11S,18S)-4,11,18-tri(propan-2-yl)-6,13,20-triselena-3,10,17,22,23,24-hexaazatetracyclo[17.2.1.1~5,8~.1~12,15~]tetracosa-1(21),5(24),7,12(23),14,19(22)-hexaene-2,9,16-trione, Multidrug resistance protein 1a | | Authors: | Aller, S.G, Yu, J, Ward, A, Weng, Y, Chittaboina, S, Zhuo, R, Harrell, P.M, Trinh, Y.T, Zhang, Q, Urbatsch, I.L, Chang, G. | | Deposit date: | 2009-02-05 | | Release date: | 2009-03-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.35 Å) | | Cite: | Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding.
Science, 323, 2009
|
|
3WBK
 | | crystal structure analysis of eukaryotic translation initiation factor 5B and 1A complex | | Descriptor: | Eukaryotic translation initiation factor 1A, Eukaryotic translation initiation factor 5B | | Authors: | Zheng, A, Yamamoto, R, Ose, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-05-20 | | Release date: | 2014-11-19 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | X-ray structures of eIF5B and the eIF5B-eIF1A complex: the conformational flexibility of eIF5B is restricted on the ribosome by interaction with eIF1A
Acta Crystallogr.,Sect.D, 70, 2014
|
|
3W79
 | | Crystal Structure of azoreductase AzrC in complex with sulfone-modified azo dye Orange I | | Descriptor: | 4-[(E)-(4-hydroxynaphthalen-1-yl)diazenyl]benzenesulfonic acid, FLAVIN MONONUCLEOTIDE, FMN-dependent NADH-azoreductase | | Authors: | Ogata, D, Yu, J, Ooi, T, Yao, M. | | Deposit date: | 2013-02-27 | | Release date: | 2014-02-12 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structures of AzrA and of AzrC complexed with substrate or inhibitor: insight into substrate specificity and catalytic mechanism.
Acta Crystallogr.,Sect.D, 70, 2014
|
|
3WGL
 | | STAPHYLOCOCCUS AUREUS FTSZ T7 mutant substituted for GAN bound with GDP, DeltaT7GAN-GDP | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-DIPHOSPHATE | | Authors: | Han, X, Matsui, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-08-06 | | Release date: | 2013-12-25 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (3.066 Å) | | Cite: | Structural change in FtsZ Induced by intermolecular interactions between bound GTP and the T7 loop
J.Biol.Chem., 289, 2014
|
|
3WGM
 | | STAPHYLOCOCCUS AUREUS FTSZ T7 mutant substituted for GAN bound with GTP, DeltaT7GAN-GTP | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION | | Authors: | Han, X, Matsui, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-08-06 | | Release date: | 2013-12-25 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.091 Å) | | Cite: | Structural change in FtsZ Induced by intermolecular interactions between bound GTP and the T7 loop
J.Biol.Chem., 289, 2014
|
|
3WBI
 | | Crystal structure analysis of eukaryotic translation initiation factor 5B structure I | | Descriptor: | Eukaryotic translation initiation factor 5B | | Authors: | Zheng, A, Yamamoto, R, Ose, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-05-20 | | Release date: | 2014-11-19 | | Last modified: | 2017-11-22 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | X-ray structures of eIF5B and the eIF5B-eIF1A complex: the conformational flexibility of eIF5B is restricted on the ribosome by interaction with eIF1A
Acta Crystallogr.,Sect.D, 70, 2014
|
|
