6UU9
| E. coli mutant sigma-S transcription initiation complex with an 8-nt RNA ("Fresh" mutant crystal soaked with GTP, UTP, CTP, and ddATP for 30 minutes) | Descriptor: | 2',3'-DIDEOXYADENOSINE-5'-MONOPHOSPHATE, DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, ... | Authors: | Zuo, Y, De, S, Steitz, T.A. | Deposit date: | 2019-10-30 | Release date: | 2020-08-26 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (5.4 Å) | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience, 23, 2020
|
|
6UU4
| E. coli sigma-S transcription initiation complex with a 3-nt RNA ("old" crystal soaked with GTP and dinucleotide GpA for 30 minutes) | Descriptor: | DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... | Authors: | Zuo, Y, De, S, Steitz, T.A. | Deposit date: | 2019-10-30 | Release date: | 2020-08-26 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (4.305 Å) | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience, 23, 2020
|
|
6UU7
| E. coli sigma-S transcription initiation complex with a 6-nt RNA and an NTP ("Old" crystal soaked with UTP, CTP, ddGTP, and dinucleotide ApG for 30 minutes) | Descriptor: | 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Zuo, Y, De, S, Steitz, T.A. | Deposit date: | 2019-10-30 | Release date: | 2020-08-26 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (4.4 Å) | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience, 23, 2020
|
|
6UTW
| E. coli sigma-S transcription initiation complex with a 4-nt RNA ("Fresh" crystal) | Descriptor: | DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Zuo, Y, De, S, Steitz, T.A. | Deposit date: | 2019-10-30 | Release date: | 2020-08-26 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.854 Å) | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience, 23, 2020
|
|
6UUC
| E. coli sigma-S transcription initiation complex with a 3-nt RNA and a mismatching ATP ("Fresh" crystal soaked with ATP for 2 hours) | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Zuo, Y, De, S, Steitz, T.A. | Deposit date: | 2019-10-30 | Release date: | 2020-08-26 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (4.096 Å) | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience, 23, 2020
|
|
6UU5
| E. coli sigma-S transcription initiation complex with a 6-nt RNA ("Old" crystal soaked with GTP, UTP, CTP, and dinucleotide GpA for 30 minutes) | Descriptor: | DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Zuo, Y, De, S, Steitz, T.A. | Deposit date: | 2019-10-30 | Release date: | 2020-08-26 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (5.403 Å) | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation. Iscience, 23, 2020
|
|
1B8H
| SLIDING CLAMP, DNA POLYMERASE | Descriptor: | DNA POLYMERASE PROCESSIVITY COMPONENT, DNA POLYMERASE fragment | Authors: | Shamoo, Y, Steitz, T.A. | Deposit date: | 1999-02-01 | Release date: | 1999-02-09 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex. Cell(Cambridge,Mass.), 99, 1999
|
|
1N8R
| Structure of large ribosomal subunit in complex with virginiamycin M | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-11-21 | Release date: | 2003-07-22 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1B77
| |
1BDN
| |
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1NJI
| Structure of chloramphenicol bound to the 50S ribosomal subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | Deposit date: | 2002-12-31 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
1YI2
| Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2005-01-11 | Release date: | 2005-04-26 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance. Cell(Cambridge,Mass.), 121, 2005
|
|
1YIJ
| Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2005-01-12 | Release date: | 2005-04-26 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance. Cell(Cambridge,Mass.), 121, 2005
|
|
1REA
| |
1YJ9
| Crystal Structure Of The Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui Containing a three residue deletion in L22 | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2005-01-13 | Release date: | 2005-04-26 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance. Cell(Cambridge,Mass.), 121, 2005
|
|
1YJN
| Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2005-01-14 | Release date: | 2005-04-26 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance. Cell(Cambridge,Mass.), 121, 2005
|
|
3CMA
| |
1XHX
| Phi29 DNA Polymerase, orthorhombic crystal form | Descriptor: | DNA polymerase, MAGNESIUM ION, SULFATE ION | Authors: | Kamtekar, S, Berman, A.J, Wang, J, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | Deposit date: | 2004-09-21 | Release date: | 2004-12-07 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Insights into Strand Displacement and Processivity from the Crystal Structure of the Protein-Primed DNA Polymerase of Bacteriophage phi29 Mol.Cell, 16, 2004
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1G6N
| 2.1 ANGSTROM STRUCTURE OF CAP-CAMP | Descriptor: | ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, CATABOLITE GENE ACTIVATOR PROTEIN | Authors: | Passner, J.M, Schultz, S.C, Steitz, T.A. | Deposit date: | 2000-11-07 | Release date: | 2000-12-15 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution. J.Mol.Biol., 304, 2000
|
|
1CSL
| CRYSTAL STRUCTURE OF THE RRE HIGH AFFINITY SITE | Descriptor: | 5'-R(*AP*AP*CP*GP*GP*GP*CP*GP*CP*AP*GP*AP*A)-3', 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*GP*UP*UP*U)-3' | Authors: | Ippolito, J.A, Steitz, T.A. | Deposit date: | 1999-08-18 | Release date: | 2000-02-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | The structure of the HIV-1 RRE high affinity rev binding site at 1.6 A resolution. J.Mol.Biol., 295, 2000
|
|
3CPW
| The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 50S ribosomal protein L10E, ... | Authors: | Ippolito, J.A, Kanyo, Z.K, Wang, D, Franceschi, F.J, Moore, P.B, Steitz, T.A, Duffy, E.M. | Deposit date: | 2008-04-01 | Release date: | 2008-07-22 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal Structure of the Oxazolidinone Antibiotic
Linezolid Bound to the 50S Ribosomal Subunit J.Med.Chem., 51, 2008
|
|
1YHQ
| Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2005-01-10 | Release date: | 2005-04-26 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance. Cell(Cambridge,Mass.), 121, 2005
|
|
1YJW
| Crystal Structure Of Quinupristin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | Descriptor: | 23S RIBOSOMAL RNA, 50S ribosomal protein L10, 50S ribosomal protein L10e, ... | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | Deposit date: | 2005-01-15 | Release date: | 2005-04-26 | Last modified: | 2024-07-10 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance. Cell(Cambridge,Mass.), 121, 2005
|
|