3OVS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ovs by Molmil](/molmil-images/mine/3ovs) | How the CCA-adding Enzyme Selects Adenine over Cytosine in Position 76 of tRNA | Descriptor: | 1,2-ETHANEDIOL, CALCIUM ION, CCA-Adding Enzyme, ... | Authors: | Pan, B.C, Xiong, Y, Steitz, T.A. | Deposit date: | 2010-09-17 | Release date: | 2010-12-01 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | How the CCA-Adding Enzyme Selects Adenine over Cytosine at Position 76 of tRNA. Science, 330, 2010
|
|
1FG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1fg0 by Molmil](/molmil-images/mine/1fg0) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1K8A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1k8a by Molmil](/molmil-images/mine/1k8a) | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1FFY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ffy by Molmil](/molmil-images/mine/1ffy) | INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN | Descriptor: | ISOLEUCYL-TRNA, ISOLEUCYL-TRNA SYNTHETASE, MAGNESIUM ION, ... | Authors: | Silvian, L.F, Wang, J, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-07 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Insights into editing from an ile-tRNA synthetase structure with tRNAile and mupirocin. Science, 285, 1999
|
|
1FFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ffz by Molmil](/molmil-images/mine/1ffz) | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
2PZS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2pzs by Molmil](/molmil-images/mine/2pzs) | Phi29 DNA polymerase complexed with primer-template DNA (post-translocation binary complex) | Descriptor: | 5'-d(CTAACACGTAAGCAGTC)-3', 5'-d(GACTGCTTAC)-3', DNA polymerase | Authors: | Berman, A.J, Kamtekar, S, Goodman, J.L, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | Deposit date: | 2007-05-18 | Release date: | 2007-07-17 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases Embo J., 26, 2007
|
|
2PY5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2py5 by Molmil](/molmil-images/mine/2py5) | Phi29 DNA polymerase complexed with single-stranded DNA | Descriptor: | 1,2-ETHANEDIOL, 5'-d(GGACTTT)-3', DNA polymerase | Authors: | Berman, A.J, Kamtekar, S, Goodman, J.L, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | Deposit date: | 2007-05-15 | Release date: | 2007-07-17 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structures of phi29 DNA polymerase complexed with substrate: the mechanism of translocation in B-family polymerases Embo J., 26, 2007
|
|
1G6N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1g6n by Molmil](/molmil-images/mine/1g6n) | 2.1 ANGSTROM STRUCTURE OF CAP-CAMP | Descriptor: | ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE, CATABOLITE GENE ACTIVATOR PROTEIN | Authors: | Passner, J.M, Schultz, S.C, Steitz, T.A. | Deposit date: | 2000-11-07 | Release date: | 2000-12-15 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution. J.Mol.Biol., 304, 2000
|
|
1MSW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1msw by Molmil](/molmil-images/mine/1msw) | |
3CME
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3cme by Molmil](/molmil-images/mine/3cme) | |
3CPW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3cpw by Molmil](/molmil-images/mine/3cpw) | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 50S ribosomal protein L10E, ... | Authors: | Ippolito, J.A, Kanyo, Z.K, Wang, D, Franceschi, F.J, Moore, P.B, Steitz, T.A, Duffy, E.M. | Deposit date: | 2008-04-01 | Release date: | 2008-07-22 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal Structure of the Oxazolidinone Antibiotic
Linezolid Bound to the 50S Ribosomal Subunit J.Med.Chem., 51, 2008
|
|
1QLN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qln by Molmil](/molmil-images/mine/1qln) | STRUCTURE OF A TRANSCRIBING T7 RNA POLYMERASE INITIATION COMPLEX | Descriptor: | BACTERIOPHAGE T7 RNA POLYMERASE, DNA (5- D (P*CP*TP*CP*CP*CP*TP*AP*TP*AP*GP*TP*GP*AP*GP*TP*CP*GP*TP* AP*TP*TP*A)-3), DNA (5-D(P*TP*AP*AP*TP*AP*CP*GP*AP*CP*TP*CP*AP*CP*TP*A)-3), ... | Authors: | Cheetham, G.M.T, Steitz, T.A. | Deposit date: | 1999-09-01 | Release date: | 2000-02-04 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of a Transcribing T7 RNA Polymerase Initiation Complex Science, 286, 1999
|
|
1WAF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1waf by Molmil](/molmil-images/mine/1waf) | DNA POLYMERASE FROM BACTERIOPHAGE RB69 | Descriptor: | DNA POLYMERASE, GUANOSINE | Authors: | Wang, J, Satter, A.K.M.A, Wang, C.C, Karam, J.D, Konigsberg, W.H, Steitz, T.A. | Deposit date: | 1997-04-13 | Release date: | 1998-01-14 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Crystal structure of a pol alpha family replication DNA polymerase from bacteriophage RB69. Cell(Cambridge,Mass.), 89, 1997
|
|
1WAJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1waj by Molmil](/molmil-images/mine/1waj) | DNA POLYMERASE FROM BACTERIOPHAGE RB69 | Descriptor: | DNA POLYMERASE, GUANOSINE-5'-MONOPHOSPHATE | Authors: | Wang, J, Satter, A.K.M.A, Wang, C.C, Karam, J.D, Konigsberg, W.H, Steitz, T.A. | Deposit date: | 1997-04-13 | Release date: | 1998-01-14 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structure of a pol alpha family replication DNA polymerase from bacteriophage RB69. Cell(Cambridge,Mass.), 89, 1997
|
|
1CEZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1cez by Molmil](/molmil-images/mine/1cez) | CRYSTAL STRUCTURE OF A T7 RNA POLYMERASE-T7 PROMOTER COMPLEX | Descriptor: | DNA (5'-D(P*TP*AP*AP*TP*AP*CP*GP*AP*CP*TP*CP*AP*CP*TP*A)-3'), DNA (5'-D(P*TP*AP*TP*AP*GP*TP*GP*AP*GP*TP*CP*GP*TP*AP*TP*TP*A)-3'), PROTEIN (BACTERIOPHAGE T7 RNA POLYMERASE) | Authors: | Cheetham, G.M.T, Jeruzalmi, D, Steitz, T.A. | Deposit date: | 1999-03-11 | Release date: | 1999-05-21 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural basis for initiation of transcription from an RNA polymerase-promoter complex. Nature, 399, 1999
|
|
1KLN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kln by Molmil](/molmil-images/mine/1kln) | DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7) MUTANT/DNA COMPLEX | Descriptor: | DNA (5'-D(*GP*CP*CP*GP*CP*GP*AP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*TP*CP*GP*CP*GP*GP*CP*GP*GP*C)-3'), PROTEIN (DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7)), ... | Authors: | Beese, L.S, Derbyshire, V, Steitz, T.A. | Deposit date: | 1994-05-24 | Release date: | 1994-11-30 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Structure of DNA polymerase I Klenow fragment bound to duplex DNA. Science, 260, 1993
|
|
1HKG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1hkg by Molmil](/molmil-images/mine/1hkg) | |
1TV6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1tv6 by Molmil](/molmil-images/mine/1tv6) | HIV-1 Reverse Transcriptase Complexed with CP-94,707 | Descriptor: | 3-[4-(2-METHYL-IMIDAZO[4,5-C]PYRIDIN-1-YL)BENZYL]-3H-BENZOTHIAZOL-2-ONE, reverse transcriptase p51 subunit, reverse transcriptase p66 subunit | Authors: | Pata, J.D, Stirtan, W.G, Goldstein, S.W, Steitz, T.A. | Deposit date: | 2004-06-28 | Release date: | 2004-07-20 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Structure of HIV-1 reverse transcriptase bound to an inhibitor active against mutant RTs resistant to other non-nucleoside inhibitors Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
2R6E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2r6e by Molmil](/molmil-images/mine/2r6e) | Crystal Form B2 | Descriptor: | Replicative helicase, SULFATE ION | Authors: | Bailey, S, Eliason, W.K, Steitz, T.A. | Deposit date: | 2007-09-05 | Release date: | 2007-11-06 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (5.019 Å) | Cite: | Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science, 318, 2007
|
|
2R6D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2r6d by Molmil](/molmil-images/mine/2r6d) | Crystal Form B1 | Descriptor: | Replicative helicase | Authors: | Bailey, S, Eliason, W.K, Steitz, T.A. | Deposit date: | 2007-09-05 | Release date: | 2008-06-10 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (3.7 Å) | Cite: | Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science, 318, 2007
|
|
1S77
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s77 by Molmil](/molmil-images/mine/1s77) | T7 RNAP product pyrophosphate elongation complex | Descriptor: | DNA (5'-D(*GP*CP*CP*GP*TP*GP*CP*GP*CP*AP*TP*TP*CP*GP*CP*CP*GP*TP*GP*TP*T)-3'), DNA (5'-D(*TP*TP*TP*AP*CP*GP*TP*TP*GP*CP*GP*CP*AP*CP*GP*GP*C)-3'), DNA-directed RNA polymerase, ... | Authors: | Yin, Y.W, Steitz, T.A. | Deposit date: | 2004-01-29 | Release date: | 2004-03-23 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.69 Å) | Cite: | The structural mechanism of translocation and helicase activity in T7 RNA polymerase. Cell(Cambridge,Mass.), 116, 2004
|
|
1K73
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1k73 by Molmil](/molmil-images/mine/1k73) | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-10-18 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|
2R6C
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2r6c by Molmil](/molmil-images/mine/2r6c) | Crystal Form BH2 | Descriptor: | DnaG Primase, Helicase Binding Domain, Replicative helicase | Authors: | Bailey, S, Eliason, W.K, Steitz, T.A. | Deposit date: | 2007-09-05 | Release date: | 2008-06-10 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (4 Å) | Cite: | Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science, 318, 2007
|
|
2R6A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2r6a by Molmil](/molmil-images/mine/2r6a) | Crystal Form BH1 | Descriptor: | DnaG Primase, Helicase Binding Domain, Replicative helicase, ... | Authors: | Bailey, S, Eliason, W.K, Steitz, T.A. | Deposit date: | 2007-09-05 | Release date: | 2007-11-06 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structure of hexameric DnaB helicase and its complex with a domain of DnaG primase Science, 318, 2007
|
|
1KC8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kc8 by Molmil](/molmil-images/mine/1kc8) | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | Descriptor: | 23S RRNA, 5S RRNA, BLASTICIDIN S, ... | Authors: | Hansen, J.L, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | Deposit date: | 2001-11-07 | Release date: | 2003-07-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.01 Å) | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit J.Mol.Biol., 330, 2003
|
|