6UU7
 
 | | E. coli sigma-S transcription initiation complex with a 6-nt RNA and an NTP ("Old" crystal soaked with UTP, CTP, ddGTP, and dinucleotide ApG for 30 minutes) | | Descriptor: | 2'-3'-DIDEOXYGUANOSINE-5'-TRIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Zuo, Y, De, S, Steitz, T.A. | | Deposit date: | 2019-10-30 | | Release date: | 2020-08-26 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (4.4 Å) | | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation.
Iscience, 23, 2020
|
|
6UTW
 | | E. coli sigma-S transcription initiation complex with a 4-nt RNA ("Fresh" crystal) | | Descriptor: | DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Zuo, Y, De, S, Steitz, T.A. | | Deposit date: | 2019-10-30 | | Release date: | 2020-08-26 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.854 Å) | | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation.
Iscience, 23, 2020
|
|
6UUC
 | | E. coli sigma-S transcription initiation complex with a 3-nt RNA and a mismatching ATP ("Fresh" crystal soaked with ATP for 2 hours) | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Zuo, Y, De, S, Steitz, T.A. | | Deposit date: | 2019-10-30 | | Release date: | 2020-08-26 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (4.096 Å) | | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation.
Iscience, 23, 2020
|
|
6UU5
 | | E. coli sigma-S transcription initiation complex with a 6-nt RNA ("Old" crystal soaked with GTP, UTP, CTP, and dinucleotide GpA for 30 minutes) | | Descriptor: | DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Zuo, Y, De, S, Steitz, T.A. | | Deposit date: | 2019-10-30 | | Release date: | 2020-08-26 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (5.403 Å) | | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation.
Iscience, 23, 2020
|
|
1K73
 | | Co-crystal Structure of Anisomycin Bound to the 50S Ribosomal Subunit | | Descriptor: | 23S RRNA, 5S RRNA, ANISOMYCIN, ... | | Authors: | Hansen, J, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-10-18 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.01 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1EFG
 | | THE CRYSTAL STRUCTURE OF ELONGATION FACTOR G COMPLEXED WITH GDP, AT 2.7 ANGSTROMS RESOLUTION | | Descriptor: | ELONGATION FACTOR G, GUANOSINE-5'-DIPHOSPHATE | | Authors: | Czworkowski, J, Wang, J, Steitz, T.A, Moore, P.B. | | Deposit date: | 1994-10-17 | | Release date: | 1995-02-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
EMBO J., 13, 1994
|
|
1QRU
 | |
1YIT
 | | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-13 | | Release date: | 2005-04-26 | | Last modified: | 2012-12-12 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
2GM5
 | | An activated, truncated gamma-delta resolvase tetramer | | Descriptor: | Transposon gamma-delta resolvase | | Authors: | Kamtekar, S, Ho, R.S, Li, W, Steitz, T.A. | | Deposit date: | 2006-04-05 | | Release date: | 2006-06-27 | | Last modified: | 2021-10-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Implications of structures of synaptic tetramers of gamma delta resolvase for the mechanism of recombination.
Proc.Natl.Acad.Sci.Usa, 103, 2006
|
|
1JJ2
 | | Fully Refined Crystal Structure of the Haloarcula marismortui Large Ribosomal Subunit at 2.4 Angstrom Resolution | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Klein, D.J, Schmeing, T.M, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-07-03 | | Release date: | 2001-08-01 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The kink-turn: a new RNA secondary structure motif.
EMBO J., 20, 2001
|
|
1FFY
 | | INSIGHTS INTO EDITING FROM AN ILE-TRNA SYNTHETASE STRUCTURE WITH TRNA(ILE) AND MUPIROCIN | | Descriptor: | ISOLEUCYL-TRNA, ISOLEUCYL-TRNA SYNTHETASE, MAGNESIUM ION, ... | | Authors: | Silvian, L.F, Wang, J, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Insights into editing from an ile-tRNA synthetase structure with tRNAile and mupirocin.
Science, 285, 1999
|
|
1REA
 | |
2PFF
 | | Structural Insights of Yeast Fatty Acid Synthase | | Descriptor: | Fatty acid synthase subunit alpha, Fatty acid synthase subunit beta, Tail protein | | Authors: | Xiong, Y, Lomakin, I.B, Steitz, T.A. | | Deposit date: | 2007-04-04 | | Release date: | 2007-07-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (4 Å) | | Cite: | Structural Insights of Yeast Fatty Acid Synthase
Cell(Cambridge,Mass.), 129, 2007
|
|
2Q7H
 | | Pyrrolysyl-tRNA synthetase bound to adenylated pyrrolysine and pyrophosphate | | Descriptor: | (2R)-2-AMINO-6-({[(2S,3R)-3-METHYLPYRROLIDIN-2-YL]CARBONYL}AMINO)HEXANOYL [(2S,3R,4R,5R)-5-(6-AMINO-9H-PURIN-9-YL)-3,4-DIHYDROXYTETRAHYDROFURAN-2-YL]METHYL HYDROGEN (R)-PHOSPHATE, 1,2-ETHANEDIOL, PYROPHOSPHATE 2-, ... | | Authors: | Kavran, J.M, Steitz, T.A. | | Deposit date: | 2007-06-06 | | Release date: | 2007-07-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structure of pyrrolysyl-tRNA synthetase, an archaeal enzyme for genetic code innovation.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1B8H
 | | SLIDING CLAMP, DNA POLYMERASE | | Descriptor: | DNA POLYMERASE PROCESSIVITY COMPONENT, DNA POLYMERASE fragment | | Authors: | Shamoo, Y, Steitz, T.A. | | Deposit date: | 1999-02-01 | | Release date: | 1999-02-09 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Building a replisome from interacting pieces: sliding clamp complexed to a peptide from DNA polymerase and a polymerase editing complex.
Cell(Cambridge,Mass.), 99, 1999
|
|
1BDN
 | |
1B77
 | |
1MSW
 | |
1CSL
 | | CRYSTAL STRUCTURE OF THE RRE HIGH AFFINITY SITE | | Descriptor: | 5'-R(*AP*AP*CP*GP*GP*GP*CP*GP*CP*AP*GP*AP*A)-3', 5'-R(*UP*CP*UP*GP*AP*CP*GP*GP*UP*AP*CP*GP*UP*UP*U)-3' | | Authors: | Ippolito, J.A, Steitz, T.A. | | Deposit date: | 1999-08-18 | | Release date: | 2000-02-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | The structure of the HIV-1 RRE high affinity rev binding site at 1.6 A resolution.
J.Mol.Biol., 295, 2000
|
|
1DFU
 | |
1IH7
 | | High-Resolution Structure of Apo RB69 DNA Polymerase | | Descriptor: | DNA POLYMERASE, GUANOSINE, POTASSIUM ION | | Authors: | Franklin, M.C, Wang, J, Steitz, T.A. | | Deposit date: | 2001-04-18 | | Release date: | 2001-06-13 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Structure of the Replicating Complex of a Pol alpha Family DNA Polymerase
Cell(Cambridge,Mass.), 105, 2001
|
|
3E0D
 | | Insights into the Replisome from the Crystral Structure of the Ternary Complex of the Eubacterial DNA Polymerase III alpha-subunit | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, CALCIUM ION, DNA polymerase III subunit alpha, ... | | Authors: | Wing, R.A, Bailey, S, Steitz, T.A. | | Deposit date: | 2008-07-31 | | Release date: | 2008-09-23 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.6 Å) | | Cite: | Insights into the Replisome from the Structure of a Ternary Complex of the DNA Polymerase III alpha-Subunit.
J.Mol.Biol., 382, 2008
|
|
3EDU
 | | Crystal structure of the ankyrin-binding domain of human erythroid spectrin | | Descriptor: | Spectrin beta chain, erythrocyte | | Authors: | Simonovic, M, Stabach, P, Simonovic, I, Steitz, T.A, Morrow, J.S. | | Deposit date: | 2008-09-03 | | Release date: | 2009-02-10 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The structure of the ankyrin-binding site of {beta}-spectrin reveals how tandem spectrin-repeats generate unique ligand-binding properties
Blood, 113, 2009
|
|
