3CPW
 
 | | The structure of the antibiotic LINEZOLID bound to the large ribosomal subunit of HALOARCULA MARISMORTUI | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(*CP*CP*AP*(PHE)*(ACA))-3', 50S ribosomal protein L10E, ... | | Authors: | Ippolito, J.A, Kanyo, Z.K, Wang, D, Franceschi, F.J, Moore, P.B, Steitz, T.A, Duffy, E.M. | | Deposit date: | 2008-04-01 | | Release date: | 2008-07-22 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal Structure of the Oxazolidinone Antibiotic
Linezolid Bound to the 50S Ribosomal Subunit
J.Med.Chem., 51, 2008
|
|
354D
 | | Structure of loop E FROM E. coli 5S RRNA | | Descriptor: | MAGNESIUM ION, RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*G)-3'), RNA-DNA (5'-R(*GP*CP*GP*AP*GP*AP*GP*UP*AP*)-D(*DGP(S)*)-R(*GP*C)-3') | | Authors: | Correll, C.C, Freeborn, B, Moore, P.B, Steitz, T.A. | | Deposit date: | 1997-10-01 | | Release date: | 1997-11-26 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain.
Cell(Cambridge,Mass.), 91, 1997
|
|
357D
 | | 3.5 A structure of fragment I from E. coli 5S RRNA | | Descriptor: | MAGNESIUM ION, MERCURY (II) ION, RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP* GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), ... | | Authors: | Correll, C.C, Freeborn, B, Moore, P.B, Steitz, T.A. | | Deposit date: | 1997-10-09 | | Release date: | 1997-12-01 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain.
Cell(Cambridge,Mass.), 91, 1997
|
|
2EFG
 | | TRANSLATIONAL ELONGATION FACTOR G COMPLEXED WITH GDP | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, PROTEIN (ELONGATION FACTOR G DOMAIN 3), PROTEIN (ELONGATION FACTOR G) | | Authors: | Czworkowski, J, Wang, J, Steitz, T.A, Moore, P.B. | | Deposit date: | 1998-09-23 | | Release date: | 1999-09-30 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
EMBO J., 13, 1994
|
|
364D
 | | 3.0 A STRUCTURE OF FRAGMENT I FROM E. COLI 5S RRNA | | Descriptor: | MAGNESIUM ION, RNA (5'-R(*CP*CP*CP*CP*AP*UP*GP*CP*GP*AP*GP*AP*GP*UP*AP*GP*G P*GP*AP*AP*CP*UP*GP*CP*CP*AP*GP*GP*CP*AP*U)-3'), RNA (5'-R(*CP*CP*GP*AP*UP*GP*GP*UP*AP*GP*UP*GP*UP*GP*GP*GP*G *UP*C)-3'), ... | | Authors: | Correll, C.C, Freeborn, B, Moore, P.B, Steitz, T.A. | | Deposit date: | 1997-12-08 | | Release date: | 1998-01-02 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Metals, motifs, and recognition in the crystal structure of a 5S rRNA domain.
Cell(Cambridge,Mass.), 91, 1997
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
3I55
 | | Co-crystal structure of Mycalamide A Bound to the Large Ribosomal Subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | | Deposit date: | 2009-07-03 | | Release date: | 2010-03-09 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.11 Å) | | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui.
Antimicrob.Agents Chemother., 53, 2009
|
|
3I56
 | | Co-crystal structure of Triacetyloleandomcyin Bound to the Large Ribosomal Subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Steitz, T.A, Moore, P.B. | | Deposit date: | 2009-07-03 | | Release date: | 2010-03-09 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structures of triacetyloleandomycin and mycalamide A bind to the large ribosomal subunit of Haloarcula marismortui.
Antimicrob.Agents Chemother., 53, 2009
|
|
2U2A
 | |
3G6E
 | | Co-crystal structure of Homoharringtonine bound to the large ribosomal subunit | | Descriptor: | (3beta)-O~3~-[(2R)-2,6-dihydroxy-2-(2-methoxy-2-oxoethyl)-6-methylheptanoyl]cephalotaxine, 23S ribosomal RNA, 50S ribosomal protein L10E, ... | | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2009-02-06 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.
J.Mol.Biol., 389, 2009
|
|
3G71
 | | Co-crystal structure of Bruceantin bound to the large ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10E, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2009-02-09 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.
J.Mol.Biol., 389, 2009
|
|
3G4S
 | | Co-crystal structure of Tiamulin bound to the large ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10, 50S ribosomal protein L10e, ... | | Authors: | Gurel, G, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2009-02-04 | | Release date: | 2009-04-28 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | U2504 determines the species specificity of the A-site cleft antibiotics: the structures of tiamulin, homoharringtonine, and bruceantin bound to the ribosome.
J.Mol.Biol., 389, 2009
|
|
2PCW
 | |
2PCV
 | |
1N8R
 | | Structure of large ribosomal subunit in complex with virginiamycin M | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-11-21 | | Release date: | 2003-07-22 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1NJI
 | | Structure of chloramphenicol bound to the 50S ribosomal subunit | | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L10e, 50S ribosomal protein L13P, ... | | Authors: | Hansen, J.L, Moore, P.B, Steitz, T.A. | | Deposit date: | 2002-12-31 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
1WTS
 | |
1WTT
 | |
1YI2
 | | Crystal Structure Of Erythromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-11 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YHQ
 | | Crystal Structure Of Azithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-10 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YIT
 | | Crystal Structure Of Virginiamycin M and S Bound To The 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S RIBOSOMAL RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-13 | | Release date: | 2005-04-26 | | Last modified: | 2024-07-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structures of Mlsbk Antibiotics Bound to Mutated Large Ribosomal Subunits Provide a Structural Explanation for Resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YIJ
 | | Crystal Structure Of Telithromycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-12 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
1YJN
 | | Crystal Structure Of Clindamycin Bound To The G2099A Mutant 50S Ribosomal Subunit Of Haloarcula Marismortui | | Descriptor: | 23S Ribosomal RNA, 50S RIBOSOMAL PROTEIN L10E, 50S RIBOSOMAL PROTEIN L11P, ... | | Authors: | Tu, D, Blaha, G, Moore, P.B, Steitz, T.A. | | Deposit date: | 2005-01-14 | | Release date: | 2005-04-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structures of MLSBK antibiotics bound to mutated large ribosomal subunits provide a structural explanation for resistance.
Cell(Cambridge,Mass.), 121, 2005
|
|
