3MGW
 
 | | Thermodynamics and structure of a salmon cold-active goose-type lysozyme | | Descriptor: | COBALT (II) ION, Lysozyme g, SULFATE ION | | Authors: | Kyomuhendo, P, Myrnes, B, Brandsdal, B.O, Smalas, A.O, Nilsen, I.W, Helland, R. | | Deposit date: | 2010-04-07 | | Release date: | 2010-05-05 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | Thermodynamics and structure of a salmon cold active goose-type lysozyme
Comp.Biochem.Physiol. B: Biochem.Mol.Biol., 156, 2010
|
|
6RCC
 | | Domain C P140 Mycoplasma genitalium | | Descriptor: | Adhesin P1, CHLORIDE ION, SODIUM ION | | Authors: | Vizarraga, D, Aparicio, D, Perez, R, Illanes, R, Fita, I. | | Deposit date: | 2019-04-11 | | Release date: | 2020-11-04 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.43 Å) | | Cite: | Alternative conformation of the C-domain of the P140 protein from Mycoplasma genitalium.
Acta Crystallogr.,Sect.F, 76, 2020
|
|
2O52
 | | Crystal structure of human RAB4B in complex with GDP | | Descriptor: | BETA-MERCAPTOETHANOL, GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, ... | | Authors: | Zhu, H, Tempel, W, Wang, J, Shen, Y, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2006-12-05 | | Release date: | 2006-12-19 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal structure of human RAB4B in complex with GDP
To be Published
|
|
6RCD
 | | Octamer C-Domain P140 Mycoplasma genitalium. | | Descriptor: | MgPa adhesin | | Authors: | Vizarraga, D, Aparicio, D, Perez, R, Illanes, R, Fita, I. | | Deposit date: | 2019-04-11 | | Release date: | 2020-11-04 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.98 Å) | | Cite: | Alternative conformation of the C-domain of the P140 protein from Mycoplasma genitalium.
Acta Crystallogr.,Sect.F, 76, 2020
|
|
2OIL
 | | Crystal structure of human RAB25 in complex with GDP | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, Ras-related protein Rab-25, ... | | Authors: | Zhu, H, Wang, J, Shen, Y, Tempel, W, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2007-01-11 | | Release date: | 2007-01-23 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structure of human RAB25 in complex with GDP
To be Published
|
|
2XDF
 | | Solution Structure of the Enzyme I Dimer Complexed with HPr Using Residual Dipolar Couplings and Small Angle X-Ray Scattering | | Descriptor: | PHOSPHOCARRIER PROTEIN HPR, PHOSPHOENOLPYRUVATE-PROTEIN PHOSPHOTRANSFERASE | | Authors: | Schwieters, C.D, Suh, J.-Y, Grishaev, A, Guirlando, R, Takayama, Y, Clore, G.M. | | Deposit date: | 2010-04-30 | | Release date: | 2010-09-22 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR, SOLUTION SCATTERING | | Cite: | Solution Structure of the 128 kDa Enzyme I Dimer from Escherichia Coli and its 146 kDa Complex with Hpr Using Residual Dipolar Couplings and Small- and Wide-Angle X-Ray Scattering.
J.Am.Chem.Soc., 132, 2010
|
|
2OLM
 | | ArfGap domain of HIV-1 Rev binding protein | | Descriptor: | GLYCEROL, Nucleoporin-like protein RIP, SULFATE ION, ... | | Authors: | Tong, Y, Tempel, W, Shen, L, Dimov, S, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2007-01-19 | | Release date: | 2007-01-30 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.48 Å) | | Cite: | ArfGap domain of HIV-1 Rev binding protein
To be Published
|
|
2OCB
 | | Crystal structure of human RAB9B in complex with a GTP analogue | | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER, Ras-related protein Rab-9B, ... | | Authors: | Hong, B, Shen, L, Walker, J.R, Tempel, W, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2006-12-20 | | Release date: | 2007-01-02 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal structure of human RAB9B in complex with a GTP analogue
To be Published
|
|
2HUP
 | | Crystal structure of human RAB43 in complex with GDP | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, RAS-related protein RAB-43, ... | | Authors: | Wang, J, Shen, Y, Tempel, W, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2006-07-27 | | Release date: | 2006-08-08 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Crystal structure of human RAB43 in complex with GDP
To be Published
|
|
5ACX
 | | VIM-2-2, Discovery of novel inhibitor scaffolds against the metallo- beta-lactamase VIM-2 by SPR based fragment screening | | Descriptor: | 2-(4-fluorophenyl)carbonylbenzoic acid, BETA-LACTAMASE, CHLORIDE ION, ... | | Authors: | Christopeit, T, Carlsen, T.J.O, Helland, R, Leiros, H.K.S. | | Deposit date: | 2015-08-18 | | Release date: | 2015-11-04 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Discovery of Novel Inhibitor Scaffolds Against the Metallo-Beta-Lactamase Vim-2 by Spr Based Fragment Screening
J.Med.Chem., 58, 2015
|
|
3O46
 | | Crystal structure of the PDZ domain of MPP7 | | Descriptor: | MAGUK p55 subfamily member 7, UNKNOWN ATOM OR ION | | Authors: | Nedyalkova, L, Tong, Y, Tempel, W, Zhong, N, Guan, X, Landry, R, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2010-07-26 | | Release date: | 2010-08-04 | | Last modified: | 2017-11-08 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Crystal structure of the PDZ domain of MPP7
TO BE PUBLISHED
|
|
4Z9M
 | | Crystal structure of human sarcomeric mitochondrial creatine kinase | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Creatine kinase S-type, mitochondrial, ... | | Authors: | Rabeh, W.M, Tempel, W, Nedyalkova, L, Landry, R, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2015-04-10 | | Release date: | 2015-04-22 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure of human sarcomeric mitochondrial creatine kinase
To Be Published
|
|
2G7F
 | | The 1.95 A crystal structure of Vibrio cholerae extracellular endonuclease I | | Descriptor: | CHLORIDE ION, Endonuclease I, MAGNESIUM ION | | Authors: | Altermark, B, Smalaas, A.O, Willassen, N.P, Helland, R. | | Deposit date: | 2006-02-28 | | Release date: | 2006-10-31 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | The structure of Vibrio cholerae extracellular endonuclease I reveals the presence of a buried chloride ion.
Acta Crystallogr.,Sect.D, 62, 2006
|
|
2G7E
 | | The 1.6 A crystal structure of Vibrio cholerae extracellular endonuclease I | | Descriptor: | CHLORIDE ION, Endonuclease I | | Authors: | Altermark, B, Smalaas, A.O, Willassen, N.P, Helland, R. | | Deposit date: | 2006-02-28 | | Release date: | 2006-10-31 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | The structure of Vibrio cholerae extracellular endonuclease I reveals the presence of a buried chloride ion.
Acta Crystallogr.,Sect.D, 62, 2006
|
|
2P5S
 | | RAB domain of human RASEF in complex with GDP | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, RAS and EF-hand domain containing, UNKNOWN ATOM OR ION | | Authors: | Zhu, H, Wang, J, Shen, Y, Tempel, W, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2007-03-16 | | Release date: | 2007-03-27 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | RAB domain of human RASEF in complex with GDP
To be Published
|
|
5ACW
 | | VIM-2-1, Discovery of novel inhibitor scaffolds against the metallo- beta-lactamase VIM-2 by SPR based fragment screening | | Descriptor: | 4-methyl-5-(trifluoromethyl)-1,2,4-triazole-3-thiol, BETA-LACTAMASE, CHLORIDE ION, ... | | Authors: | Christopeit, T, Carlsen, T.J.O, Helland, R, Leiros, H.K.S. | | Deposit date: | 2015-08-18 | | Release date: | 2015-11-04 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Discovery of Novel Inhibitor Scaffolds Against the Metallo-Beta-Lactamase Vim-2 by Spr Based Fragment Screening
J.Med.Chem., 58, 2015
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
2KDT
 | | PC1/3 DCSG sorting domain structure in DPC | | Descriptor: | Neuroendocrine convertase 1 | | Authors: | Dikeakos, J.D, Di Lello, P, Lacombe, M.J, Ghirlando, R, Legault, P, Reudelhuber, T.L, Omichinski, J.G. | | Deposit date: | 2009-01-19 | | Release date: | 2009-04-07 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Functional and structural characterization of a dense core secretory granule sorting domain from the PC1/3 protease.
Proc.Natl.Acad.Sci.USA, 106, 2009
|
|
3B6U
 | | Crystal structure of the motor domain of human kinesin family member 3B in complex with ADP | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Kinesin-like protein KIF3B, MAGNESIUM ION, ... | | Authors: | Zhu, H, Shen, Y, Tempel, W, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2007-10-29 | | Release date: | 2007-11-13 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Motor domain of human kinesin family member 3B in complex with ADP.
To be Published
|
|
2KE3
 | | PC1/3 DCSG sorting domain in CHAPS | | Descriptor: | Neuroendocrine convertase 1 | | Authors: | Dikeakos, J.D, Di Lello, P, Lacombe, M.J, Ghirlando, R, Legault, P, Reudelhuber, T.L, Omichinski, J.G. | | Deposit date: | 2009-01-22 | | Release date: | 2009-04-14 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Functional and structural characterization of a dense core secretory granule sorting domain from the PC1/3 protease
Proc.Natl.Acad.Sci.USA, 106, 2009
|
|
3B6V
 | | Crystal structure of the motor domain of human kinesin family member 3C in complex with ADP | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Kinesin-like protein KIF3C, MAGNESIUM ION, ... | | Authors: | Zhu, H, Tempel, W, Shen, Y, Landry, R, Arrowsmith, C.H, Edwards, A.M, Sundstrom, M, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2007-10-29 | | Release date: | 2007-11-13 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Motor domain of human kinesin family member 3C in complex with ADP.
To be Published
|
|
2KKW
 | | SLAS-micelle bound alpha-synuclein | | Descriptor: | Alpha-synuclein | | Authors: | Rao, J, Jao, C.C, Hegde, B, Langen, R, Ulmer, T.S. | | Deposit date: | 2009-06-29 | | Release date: | 2010-06-16 | | Last modified: | 2024-05-01 | | Method: | EPR, SOLUTION NMR | | Cite: | A combinatorial NMR and EPR approach for evaluating the structural ensemble of partially folded proteins.
J.Am.Chem.Soc., 132, 2010
|
|
2L5H
 | | Solution Structure of the H189Q mutant of the Enzyme I dimer Using Residual Dipolar Couplings and Small Angle X-Ray Scattering | | Descriptor: | Phosphoenolpyruvate-protein phosphotransferase | | Authors: | Takayama, Y.D, Schwieters, C.D, Grishaev, A, Guirlando, R, Clore, G. | | Deposit date: | 2010-11-01 | | Release date: | 2011-01-12 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR, SOLUTION SCATTERING | | Cite: | Combined Use of Residual Dipolar Couplings and Solution X-ray Scattering To Rapidly Probe Rigid-Body Conformational Transitions in a Non-phosphorylatable Active-Site Mutant of the 128 kDa Enzyme I Dimer.
J.Am.Chem.Soc., 133, 2011
|
|
2L5A
 | | Structural basis for recognition of centromere specific histone H3 variant by nonhistone Scm3 | | Descriptor: | Histone H3-like centromeric protein CSE4, Protein SCM3, Histone H4 | | Authors: | Zhou, Z, Feng, H, Zhou, B, Ghirlando, R, Hu, K, Zwolak, A, Jenkins, L, Xiao, H, Tjandra, N, Wu, C, Bai, Y. | | Deposit date: | 2010-10-28 | | Release date: | 2011-03-16 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structural basis for recognition of centromere histone variant CenH3 by the chaperone Scm3.
Nature, 472, 2011
|
|
2M8L
 | | HIV capsid dimer structure | | Descriptor: | Capsid protein p24 | | Authors: | Deshmukh, L, Schwieters, C.D, Grishaev, A, Clore, G, Ghirlando, R. | | Deposit date: | 2013-05-23 | | Release date: | 2013-11-20 | | Last modified: | 2023-06-14 | | Method: | SOLUTION NMR, SOLUTION SCATTERING | | Cite: | Structure and Dynamics of Full-Length HIV-1 Capsid Protein in Solution.
J.Am.Chem.Soc., 135, 2013
|
|
