3JRH
| |
6QQ5
| Cryo-EM structure of dimeric quinol dependent nitric oxide reductase (qNOR) from Alcaligenes xylosoxidans | Descriptor: | CALCIUM ION, FE (III) ION, Nitric oxide reductase subunit B, ... | Authors: | Gopalasingam, C.C, Johnson, R.M, Chiduza, G.N, Tosha, T, Yamamoto, M, Shiro, Y, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | Deposit date: | 2019-02-17 | Release date: | 2019-09-11 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Dimeric structures of quinol-dependent nitric oxide reductases (qNORs) revealed by cryo-electron microscopy. Sci Adv, 5, 2019
|
|
4PTF
| Ternary crystal structure of yeast DNA polymerase epsilon with template G | Descriptor: | 1,2-ETHANEDIOL, 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*(DOC))-3', ... | Authors: | Jain, R, Rajashankar, K.R, Buku, A, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | Deposit date: | 2014-03-10 | Release date: | 2014-04-30 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.809 Å) | Cite: | Crystal Structure of Yeast DNA Polymerase epsilon Catalytic Domain. Plos One, 9, 2014
|
|
3IV5
| |
3JR9
| |
3JRD
| |
3JRB
| |
3JRA
| |
3JRG
| |
3JRC
| |
3JRI
| |
3JRE
| |
3PZP
| Human DNA polymerase kappa extending opposite a cis-syn thymine dimer | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*CP*A)-3', 5'-D(*TP*TP*CP*CP*(TTD)P*GP*GP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3', ... | Authors: | Vasquez-Del Carpio, R, Silverstein, T.D, Lone, S, Johnson, R.E, Prakash, S, Prakash, L, Aggarwal, A.K. | Deposit date: | 2010-12-14 | Release date: | 2011-12-28 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (3.336 Å) | Cite: | Role of human DNA polymerase kappa in extension opposite from a cis-syn thymine dimer. J.Mol.Biol., 408, 2011
|
|
3TQ1
| Human DNA Polymerase eta in binary complex with DNA | Descriptor: | DNA (5'-D(*TP*AP*GP*CP*GP*TP*CP*AP*T)-3'), DNA (5'-D(*TP*CP*AP*TP*TP*AP*TP*GP*AP*CP*GP*CP*T)-3'), DNA polymerase eta | Authors: | Ummat, A, Silverstein, T.D, Jain, R, Buku, A, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | Deposit date: | 2011-09-08 | Release date: | 2012-02-08 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.556 Å) | Cite: | Human DNA Polymerase Eta Is Pre-Aligned for dNTP Binding and Catalysis. J.Mol.Biol., 415, 2012
|
|
7LCI
| PF 06882961 bound to the glucagon-like peptide-1 receptor (GLP-1R):Gs complex | Descriptor: | 2-[(4-{6-[(4-cyano-2-fluorophenyl)methoxy]pyridin-2-yl}piperidin-1-yl)methyl]-1-{[(2S)-oxetan-2-yl]methyl}-1H-benzimidazole-6-carboxylic acid, Glucagon-like peptide 1 receptor, Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-2, ... | Authors: | Belousoff, M.J, Johnson, R.M, Drulyte, I, Yu, L, Kotecha, A, Danev, R, Wootten, D, Zhang, X, Sexton, P.M. | Deposit date: | 2021-01-11 | Release date: | 2021-01-20 | Last modified: | 2021-09-15 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Evolving cryo-EM structural approaches for GPCR drug discovery. Structure, 29, 2021
|
|
7LCJ
| PF 06882961 bound to the glucagon-like peptide-1 receptor (GLP-1R):Gs complex | Descriptor: | 2-[(4-{6-[(4-cyano-2-fluorophenyl)methoxy]pyridin-2-yl}piperidin-1-yl)methyl]-1-{[(2S)-oxetan-2-yl]methyl}-1H-benzimidazole-6-carboxylic acid, Glucagon-like peptide 1 receptor | Authors: | Belousoff, M.J, Johnson, R.M, Drulyte, I, Yu, L, Kotecha, A, Danev, R, Wootten, D, Zhang, X, Sexton, P.M. | Deposit date: | 2021-01-11 | Release date: | 2021-01-20 | Last modified: | 2021-09-15 | Method: | ELECTRON MICROSCOPY (2.82 Å) | Cite: | Evolving cryo-EM structural approaches for GPCR drug discovery. Structure, 29, 2021
|
|
7LCK
| PF 06882961 bound to the glucagon-like peptide-1 receptor (GLP-1R) | Descriptor: | 2-[(4-{6-[(4-cyano-2-fluorophenyl)methoxy]pyridin-2-yl}piperidin-1-yl)methyl]-1-{[(2S)-oxetan-2-yl]methyl}-1H-benzimidazole-6-carboxylic acid, Glucagon-like peptide 1 receptor | Authors: | Belousoff, M.J, Johnson, R.M, Drulyte, I, Yu, L, Kotecha, A, Danev, R, Wootten, D, Zhang, X, Sexton, P.M. | Deposit date: | 2021-01-11 | Release date: | 2021-01-20 | Last modified: | 2021-09-15 | Method: | ELECTRON MICROSCOPY (3.24 Å) | Cite: | Evolving cryo-EM structural approaches for GPCR drug discovery. Structure, 29, 2021
|
|
3FIS
| THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING | Descriptor: | FACTOR FOR INVERSION STIMULATION (FIS) | Authors: | Yuan, H.S, Finkel, S.E, Feng, J-A, Johnson, R.C, Dickerson, R.E. | Deposit date: | 1991-08-12 | Release date: | 1993-10-31 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | The molecular structure of wild-type and a mutant Fis protein: relationship between mutational changes and recombinational enhancer function or DNA binding. Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
4EEY
| Crystal structure of human DNA polymerase eta in ternary complex with a cisplatin DNA adduct | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*CP*TP*TP*GP*GP*TP*CP*TP*CP*CP*TP*CP*C)-3', 5'-D(*TP*GP*GP*AP*GP*GP*AP*GP*A)-3', ... | Authors: | Ummat, A, Rechkoblit, O, Jain, R, Choudhury, J.R, Johnson, R.E, Silverstein, T.D, Buku, A, Lone, S, Prakash, L, Prakash, S, Aggarwal, A.K. | Deposit date: | 2012-03-28 | Release date: | 2012-05-09 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.32 Å) | Cite: | Structural basis for cisplatin DNA damage tolerance by human polymerase {eta} during cancer chemotherapy. Nat.Struct.Mol.Biol., 19, 2012
|
|
1FIP
| THE STRUCTURE OF FIS MUTANT PRO61ALA ILLUSTRATES THAT THE KINK WITHIN THE LONG ALPHA-HELIX IS NOT DUE TO THE PRESENCE OF THE PROLINE RESIDUE | Descriptor: | FACTOR FOR INVERSION STIMULATION (FIS), UNKNOWN PEPTIDE, POSSIBLY PART OF THE UNOBSERVED RESIDUES IN ENTITY 1 | Authors: | Yuan, H.S, Wang, S.S, Yang, W.-Z, Finkel, S.E, Johnson, R.C. | Deposit date: | 1994-09-26 | Release date: | 1995-02-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | The structure of Fis mutant Pro61Ala illustrates that the kink within the long alpha-helix is not due to the presence of the proline residue. J.Biol.Chem., 269, 1994
|
|
1IJW
| Testing the Water-Mediated Hin Recombinase DNA Recognition by Systematic Mutations. | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*(CBR)P*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*GP*A)-3', ... | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-04-30 | Release date: | 2002-02-22 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
1JKQ
| Testing the Water-Mediated HIN Recombinase DNA Recognition by Systematic Mutations | Descriptor: | 5'-D(*AP*TP*CP*TP*TP*AP*TP*AP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*TP*AP*TP*AP*AP*GP*A)-3', DNA-INVERTASE HIN | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-07-13 | Release date: | 2002-02-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
5E3L
| |
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
5DTD
| |