7LCK
 
 | | PF 06882961 bound to the glucagon-like peptide-1 receptor (GLP-1R) | | Descriptor: | 2-[(4-{6-[(4-cyano-2-fluorophenyl)methoxy]pyridin-2-yl}piperidin-1-yl)methyl]-1-{[(2S)-oxetan-2-yl]methyl}-1H-benzimidazole-6-carboxylic acid, Glucagon-like peptide 1 receptor | | Authors: | Belousoff, M.J, Johnson, R.M, Drulyte, I, Yu, L, Kotecha, A, Danev, R, Wootten, D, Zhang, X, Sexton, P.M. | | Deposit date: | 2021-01-11 | | Release date: | 2021-01-20 | | Last modified: | 2021-09-15 | | Method: | ELECTRON MICROSCOPY (3.24 Å) | | Cite: | Evolving cryo-EM structural approaches for GPCR drug discovery.
Structure, 29, 2021
|
|
6QQ6
 | | Cryo-EM structure of dimeric quinol dependent nitric oxide reductase (qNOR) Val495Ala mutant from Alcaligenes xylosoxidans | | Descriptor: | (1R)-2-{[(R)-(2-AMINOETHOXY)(HYDROXY)PHOSPHORYL]OXY}-1-[(DODECANOYLOXY)METHYL]ETHYL (9Z)-OCTADEC-9-ENOATE, CALCIUM ION, DODECYL-BETA-D-MALTOSIDE, ... | | Authors: | Gopalasingam, C.C, Johnson, R.M, Chiduza, G.N, Tosha, T, Yamamoto, M, Shiro, Y, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-02-17 | | Release date: | 2019-09-11 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Dimeric structures of quinol-dependent nitric oxide reductases (qNORs) revealed by cryo-electron microscopy.
Sci Adv, 5, 2019
|
|
6L3H
 | | Cryo-EM structure of dimeric quinol dependent Nitric Oxide Reductase (qNOR) from the pathogen Neisseria meninigitidis | | Descriptor: | CALCIUM ION, FE (III) ION, Nitric-oxide reductase, ... | | Authors: | Jamali, M.M.A, Gopalasingam, C.C, Johnson, R.M, Tosha, T, Muench, S.P, Muramoto, K, Antonyuk, S.V, Shiro, Y, Hasnain, S.S. | | Deposit date: | 2019-10-11 | | Release date: | 2020-04-01 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (3.06 Å) | | Cite: | The active form of quinol-dependent nitric oxide reductase fromNeisseria meningitidisis a dimer.
Iucrj, 7, 2020
|
|
5E3L
 | |
5DTD
 | |
5DS9
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
5E3N
 | |
5E3O
 | |
3BJY
 | | Catalytic core of Rev1 in complex with DNA (modified template guanine) and incoming nucleotide | | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, DNA (5'-D(*DAP*DTP*DCP*DCP*DTP*DCP*DCP*DCP*DCP*DTP*DAP*(DOC))-3'), DNA (5'-D(*DTP*DAP*DAP*(P)P*DGP*DTP*DAP*DGP*DGP*DGP*DGP*DAP*DGP*DGP*DAP*DT)-3'), ... | | Authors: | Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2007-12-05 | | Release date: | 2008-10-28 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.41 Å) | | Cite: | Protein-template-directed synthesis across an acrolein-derived DNA adduct by yeast Rev1 DNA polymerase
Structure, 16, 2008
|
|
6T6V
 | | Glu-494-Ala inactive monomer of a quinol dependent Nitric Oxide Reductase (qNOR) from Alcaligenes xylosoxidans | | Descriptor: | CALCIUM ION, Nitric oxide reductase subunit B, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Gopalasingam, C.C, Johnson, R.M, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-10-19 | | Release date: | 2020-04-01 | | Last modified: | 2024-05-22 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | The active form of quinol-dependent nitric oxide reductase fromNeisseria meningitidisis a dimer.
Iucrj, 7, 2020
|
|
6QQ5
 | | Cryo-EM structure of dimeric quinol dependent nitric oxide reductase (qNOR) from Alcaligenes xylosoxidans | | Descriptor: | CALCIUM ION, FE (III) ION, Nitric oxide reductase subunit B, ... | | Authors: | Gopalasingam, C.C, Johnson, R.M, Chiduza, G.N, Tosha, T, Yamamoto, M, Shiro, Y, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-02-17 | | Release date: | 2019-09-11 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.9 Å) | | Cite: | Dimeric structures of quinol-dependent nitric oxide reductases (qNORs) revealed by cryo-electron microscopy.
Sci Adv, 5, 2019
|
|
3ITE
 | | The third adenylation domain of the fungal SidN non-ribosomal peptide synthetase | | Descriptor: | CHLORIDE ION, SULFATE ION, SidN siderophore synthetase | | Authors: | Lee, T.V, Lott, J.S, Johnson, R.D, Johnson, L.J, Arcus, V.L. | | Deposit date: | 2009-08-28 | | Release date: | 2009-11-17 | | Last modified: | 2014-02-05 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structure of a eukaryotic nonribosomal peptide synthetase adenylation domain that activates a large hydroxamate amino acid in siderophore biosynthesis
J.Biol.Chem., 285, 2010
|
|
6DGC
 | | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
6DGB
 | | Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase | | Descriptor: | IS607 family transposase IS1535 | | Authors: | Chen, W.Y, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.52 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
3JRF
 | |
3IV5
 | |
3JR9
 | |
3JRD
 | |
1LX8
 | | Regulation of directionality in bacteriophage lambda site-specific recombination: structure of the Xis protein | | Descriptor: | Excisionase | | Authors: | Sam, M.D, Papagiannis, C, Connolly, K.M, Corselli, L, Iwahara, J, Lee, J, Phillips, M, Wojciak, J.M, Johnson, R.C, Clubb, R.T. | | Deposit date: | 2002-06-04 | | Release date: | 2003-06-10 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Regulation of directionality in bacteriophage lambda site-specific recombination: structure of the Xis protein
J.Mol.Biol., 324, 2002
|
|
1HCR
 | |
3H40
 | | Binary complex of human DNA polymerase iota with template U/T | | Descriptor: | 5'-D(*AP*GP*GP*AP*CP*CP*(DOC))-3', 5'-D(*TP*(BRU)P*GP*GP*GP*TP*CP*CP*T)-3', DNA polymerase iota, ... | | Authors: | Jain, R, Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2009-04-17 | | Release date: | 2009-07-21 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Replication across template T/U by human DNA polymerase-iota.
Structure, 17, 2009
|
|
3H4D
 | | Ternary complex of human DNA polymerase iota with template U/T and incoming dGTP | | Descriptor: | 2'-DEOXYGUANOSINE-5'-TRIPHOSPHATE, 5'-D(*AP*GP*GP*AP*CP*CP*(DOC)), 5'-D(*TP*(BRU)P*GP*GP*GP*TP*CP*CP*T), ... | | Authors: | Jain, R, Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2009-04-18 | | Release date: | 2009-07-21 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Replication across template T/U by human DNA polymerase-iota.
Structure, 17, 2009
|
|
1IJW
 | | Testing the Water-Mediated Hin Recombinase DNA Recognition by Systematic Mutations. | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*(CBR)P*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*GP*A)-3', ... | | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | | Deposit date: | 2001-04-30 | | Release date: | 2002-02-22 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Testing water-mediated DNA recognition by the Hin recombinase.
EMBO J., 21, 2002
|
|
3H4B
 | | Ternary complex of human DNA polymerase iota with template U/T and incoming dATP | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*AP*GP*GP*AP*CP*CP*(DOC))-3', 5'-D(*TP*(BRU)P*GP*GP*GP*TP*CP*CP*T)-3', ... | | Authors: | Jain, R, Nair, D.T, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2009-04-18 | | Release date: | 2009-07-21 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Replication across template T/U by human DNA polymerase-iota.
Structure, 17, 2009
|
|
