6Q94
 
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase (S156D) in complex with GDP-Man | | Descriptor: | 1,2-ETHANEDIOL, GDP-mannose 4,6 dehydratase, GUANOSINE-5'-DIPHOSPHATE-ALPHA-D-MANNOSE, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-12-17 | | Release date: | 2019-04-24 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
5A3N
 | | Crystal structure of human PLU-1 (JARID1B) in complex with KDOAM25a | | Descriptor: | 1,2-ETHANEDIOL, 2-[[[2-[2-(dimethylamino)ethyl-ethyl-amino]-2-oxidanylidene-ethyl]amino]methyl]pyridine-4-carboxamide, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Nuzzi, A, Ruda, G.F, Kopec, J, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Brennan, P, Oppermann, U. | | Deposit date: | 2015-06-02 | | Release date: | 2015-07-08 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Potent and Selective KDM5 Inhibitor Stops Cellular Demethylation of H3K4me3 at Transcription Start Sites and Proliferation of MM1S Myeloma Cells.
Cell Chem Biol, 24, 2017
|
|
5A3P
 | | Crystal structure of the catalytic domain of human PLU1 (JARID1B). | | Descriptor: | 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, LYSINE-SPECIFIC DEMETHYLASE 5B, ... | | Authors: | Nowak, R, Srikannathasan, V, Johansson, C, Gileadi, C, Tallant, C, Kupinska, K, Strain-Damerell, C, Szykowska, A, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2015-06-02 | | Release date: | 2015-06-10 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.008 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
5A1H
 | | Crystal structure of human Spindlin3 | | Descriptor: | SPINDLIN-3 | | Authors: | Srikannathasan, V, Gileadi, C, Johansson, C, Shrestha, L, Tallon, R, Burgess-Brown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2015-04-30 | | Release date: | 2015-06-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of Human Spindlin3
To be Published
|
|
5A1L
 | | Crystal structure of JmjC domain of human histone demethylase UTY with S21056a | | Descriptor: | 1,2-ETHANEDIOL, 3-[[2-pyridin-2-yl-6-(1,2,4,5-tetrahydro-3-benzazepin-3-yl)pyrimidin-4-yl]amino]propan-1-ol, FE (II) ION, ... | | Authors: | Srikannathasan, V, Gileadi, C, Johansson, C, Krojer, T, Tumber, A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Brennan, P, Oppermann, U. | | Deposit date: | 2015-05-01 | | Release date: | 2015-06-17 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of Jmjc Domain of Human Histone Demethylase Uty with S21056A
To be Published
|
|
5A1F
 | | Crystal structure of the catalytic domain of PLU1 in complex with N-oxalylglycine. | | Descriptor: | 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, LYSINE-SPECIFIC DEMETHYLASE 5B, ... | | Authors: | Srikannathasan, V, Johansson, C, Strain-Damerell, C, Gileadi, C, Szykowska, A, Kupinska, K, Kopec, J, Krojer, T, Steuber, H, von Delft, F, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2015-04-29 | | Release date: | 2015-05-06 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
5A3W
 | | Crystal structure of human PLU-1 (JARID1B) in complex with Pyridine-2, 6-dicarboxylic Acid (PDCA) | | Descriptor: | 1,2-ETHANEDIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, LYSINE-SPECIFIC DEMETHYLASE 5B, ... | | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Kopec, J, Strain-Damerell, C, Kupinska, K, Burgess-Brown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2015-06-03 | | Release date: | 2015-06-17 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
5A3T
 | | Crystal structure of human PLU-1 (JARID1B) in complex with KDM5-C49 (2-(((2-((2-(dimethylamino)ethyl)(ethyl)amino)-2-oxoethyl)amino)methyl) isonicotinic acid). | | Descriptor: | 1,2-ETHANEDIOL, 2-{[(2-{[(E)-2-(dimethylamino)ethenyl](ethyl)amino}-2-oxoethyl)amino]methyl}pyridine-4-carboxylic acid, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ... | | Authors: | Srikannathasan, V, Johansson, C, Gileadi, C, Kopec, J, Strain-Damerell, C, Kupinska, K, BurgessBrown, N.A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | | Deposit date: | 2015-06-02 | | Release date: | 2015-06-17 | | Last modified: | 2016-06-29 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structural Analysis of Human Kdm5B Guides Histone Demethylase Inhibitor Development.
Nat.Chem.Biol., 12, 2016
|
|
5F5I
 | | Crystal Structure of human JMJD2A complexed with KDOOA011340 | | Descriptor: | 2-[[(phenylmethyl)amino]methyl]pyridine-4-carboxylic acid, Lysine-specific demethylase 4A, NICKEL (II) ION, ... | | Authors: | Krojer, T, Vollmar, M, Crawley, L, Szykowska, A, Gileadi, C, Johansson, C, England, K, Yang, H, Burgess-Brown, N, Brennan, P, Bountra, C, Arrowsmith, C.H, Edwards, A, Oppermann, U, von Delft, F, Structural Genomics Consortium (SGC) | | Deposit date: | 2015-12-04 | | Release date: | 2015-12-30 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | 8-Substituted Pyrido[3,4-d]pyrimidin-4(3H)-one Derivatives As Potent, Cell Permeable, KDM4 (JMJD2) and KDM5 (JARID1) Histone Lysine Demethylase Inhibitors.
J.Med.Chem., 59, 2016
|
|
6GPK
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase (E157Q) in complex with GDP-Man | | Descriptor: | 1,2-ETHANEDIOL, GDP-mannose 4,6 dehydratase, GLYCEROL, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-06-06 | | Release date: | 2018-07-18 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.47 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
1ZSY
 | | The structure of human mitochondrial 2-enoyl thioester reductase (CGI-63) | | Descriptor: | GLYCEROL, MITOCHONDRIAL 2-ENOYL THIOESTER REDUCTASE, SULFATE ION | | Authors: | Lukacik, P, Shafqat, N, Kavanagh, K.L, Johansson, C, Smee, C, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-05-25 | | Release date: | 2005-06-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.75 Å) | | Cite: | The structure of human mitochondrial 2-enoyl thioester reductase (CGI-63)
To be Published
|
|
1ZSV
 | | Crystal structure of human NADP-dependent leukotriene B4 12-hydroxydehydrogenase | | Descriptor: | CHLORIDE ION, NADP-dependent leukotriene B4 12-hydroxydehydrogenase | | Authors: | Turnbull, A.P, Johansson, C, Savitsky, P, Guo, K, Edwards, A, Arrowsmith, C, Sundstrom, M, von Delft, F, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2005-05-25 | | Release date: | 2005-06-21 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structure of human NADP-dependent leukotriene B4 12-hydroxydehydrogenase
To be Published
|
|
6GPL
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase in complex with GDP-4k6d-Man | | Descriptor: | 1,2-ETHANEDIOL, BICINE, GDP-mannose 4,6 dehydratase, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-06-06 | | Release date: | 2018-07-18 | | Last modified: | 2024-05-15 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
6GPJ
 | | Crystal structure of human GDP-D-mannose 4,6-dehydratase in complex with GDP-4F-Man | | Descriptor: | 1,2-ETHANEDIOL, CITRIC ACID, GDP-mannose 4,6 dehydratase, ... | | Authors: | Pfeiffer, M, Krojer, T, Johansson, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Nidetzky, B, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2018-06-06 | | Release date: | 2018-07-18 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | A Parsimonious Mechanism of Sugar Dehydration by Human GDP-Mannose-4,6-dehydratase.
Acs Catalysis, 9, 2019
|
|
3ZLI
 | | Crystal structure of JmjC domain of human histone demethylase UTY | | Descriptor: | 1,2-ETHANEDIOL, 2-OXOGLUTARIC ACID, FE (II) ION, ... | | Authors: | Vollmar, M, Gileadi, C, Shrestha, L, Goubin, S, Johansson, C, Krojer, T, Raynor, J.W, Bradley, A, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2013-01-31 | | Release date: | 2013-02-27 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Human Uty(Kdm6C) is a Male-Specific Nepsilon-Methyl Lysyl Demethylase.
J.Biol.Chem., 289, 2014
|
|
3ZYW
 | | Crystal structure of the first glutaredoxin domain of human glutaredoxin 3 (GLRX3) | | Descriptor: | 1,2-ETHANEDIOL, GLUTAREDOXIN-3 | | Authors: | Vollmar, M, Johansson, C, Cocking, R, Krojer, T, Muniz, J.R.C, Kavanagh, K.L, von Delft, F, Bountra, C, Arrowsmith, C.H, Weigelt, J, Edwards, A, Oppermann, U. | | Deposit date: | 2011-08-29 | | Release date: | 2012-02-29 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.84 Å) | | Cite: | Crystal Structure of the First Glutaredoxin Domain of Human Glutaredoxin 3 (Glrx3)
To be Published
|
|
3ZPO
 | | Crystal structure of JmjC domain of human histone demethylase UTY with bound GSK J1 | | Descriptor: | 1,2-ETHANEDIOL, 3-[[2-pyridin-2-yl-6-(1,2,4,5-tetrahydro-3-benzazepin-3-yl)pyrimidin-4-yl]amino]propanoic acid, FE (II) ION, ... | | Authors: | Vollmar, M, Gileadi, C, Shrestha, L, Goubin, S, Johansson, C, Krojer, T, von Delft, F, Arrowsmith, C.H, Bountra, C, Edwards, A, Oppermann, U. | | Deposit date: | 2013-02-28 | | Release date: | 2013-05-29 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Human Uty(Kdm6C) is a Male-Specific Nepislon-Methyl Lysyl Demethylase.
J.Biol.Chem., 289, 2014
|
|
4AAP
 | | Crystal structure of JMJD5 domain of human Lysine-specific demethylase 8 (KDM8) in complex with N-oxalylglycine (NOG) | | Descriptor: | LYSINE-SPECIFIC DEMETHYLASE 8, N-OXALYLGLYCINE, ZINC ION | | Authors: | Vollmar, M, Johansson, C, Krojer, T, Canning, P, Allerston, C, Gadhave, A, von Delft, F, Bountra, C, Arrowsmith, C.H, Weigelt, J, Edwards, A, Oppermann, U. | | Deposit date: | 2011-12-05 | | Release date: | 2012-02-29 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal Structure of Jmjd5 Domain of Human Lysine- Specific Demethylase 8 (Kdm8) in Complex with N- Oxalylglycine (Nog)
To be Published
|
|
4AQH
 | | Plasminogen activator inhibitor type-1 in complex with the inhibitor AZ3976 | | Descriptor: | PLASMINOGEN ACTIVATOR INHIBITOR 1, TERT-BUTYL 3-[(4-OXO-3H-PYRIDO[2,3-D]PYRIMIDIN-2-YL)AMINO]AZETIDINE-1-CARBOXYLATE | | Authors: | Fjellstrom, O, Deinum, J, Sjogren, T, Johansson, C, Geschwindner, S, Nerme, V, Legnehed, A, McPheat, J, Olsson, K, Bodin, C, Gustafsson, D. | | Deposit date: | 2012-04-17 | | Release date: | 2012-11-28 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Characterization of a Small Molecule Inhibitor of Plasminogen Activator Inhibitor Type 1 that Accelerates the Transition Into the Latent Conformation
J.Biol.Chem., 288, 2013
|
|
3H8Q
 | | Crystal structure of glutaredoxin domain of human thioredoxin reductase 3 | | Descriptor: | CHLORIDE ION, SULFATE ION, Thioredoxin reductase 3 | | Authors: | Chaikuad, A, Johansson, C, Ugochukwu, E, Roos, A.K, von Delft, F, Pilka, E, Yue, W, Arrowsmith, C.H, Edwards, A.M, Weigelt, J, Bountra, C, Oppermann, U, Structural Genomics Consortium (SGC) | | Deposit date: | 2009-04-29 | | Release date: | 2009-05-12 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Crystal structure of glutaredoxin domain of human thioredoxin reductase 3
To be Published
|
|
3UIW
 | | Zebrafish Grx2 (APO) | | Descriptor: | GLUTATHIONE, Glutaredoxin 2, SULFATE ION | | Authors: | McDonough, M.A, Johansson, C. | | Deposit date: | 2011-11-06 | | Release date: | 2013-03-27 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.601 Å) | | Cite: | A New Mode of Iron-sulfur Cluster Coordination in Glutaredoxins is Crucial for Axonogenesis
To be Published
|
|
1Y2Y
 | | Structural Characterization of Nop10p using Nuclear Magnetic Resonance Spectroscopy | | Descriptor: | Ribosome biogenesis protein Nop10 | | Authors: | Khanna, M, Wu, H, Johansson, C, Caizergues-Ferrer, M, Feigon, J. | | Deposit date: | 2004-11-23 | | Release date: | 2005-12-06 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Structural study of the H/ACA snoRNP components Nop10p and the 3' hairpin of U65 snoRNA
RNA, 12, 2006
|
|
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
2UZP
 | | Crystal structure of the C2 domain of human protein kinase C gamma. | | Descriptor: | 1,2-ETHANEDIOL, CALCIUM ION, COBALT (II) ION, ... | | Authors: | Pike, A.C.W, Amos, A, Johansson, C, Sobott, F, Savitsky, P, Berridge, G, Fedorov, O, Umeano, C, Gorrec, F, Bunkoczi, G, Debreczeni, J, von Delft, F, Arrowsmith, C.H, Edwards, A, Weigelt, J, Sundstrom, M, Knapp, S. | | Deposit date: | 2007-04-30 | | Release date: | 2007-05-29 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of C2 Domain of Protein Kinase C Gamma
To be Published
|
|
2YAN
 | | Crystal structure of the second glutaredoxin domain of human TXNL2 | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, FE (III) ION, ... | | Authors: | Vollmar, M, Johansson, C, Cocking, R, Muniz, J.R.C, Krojer, T, Allerston, C, von Delft, F, Bountra, C, Arrowsmith, C.H, Weigelt, J, Edwards, A, Oppermann, U. | | Deposit date: | 2011-02-23 | | Release date: | 2011-11-30 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Crystal Structure of the Second Glutaredoxin Domain of Human Txnl2
To be Published
|
|
