6P0U
 
 | | Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
6P0T
 | | Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.603 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
6P0S
 | | Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis | | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2019-05-17 | | Release date: | 2019-06-19 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity.
Nucleic Acids Res., 47, 2019
|
|
6DGC
 | | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
5DTD
 | |
5E3L
 | |
5DS9
 | |
5E3O
 | |
5E3N
 | |
4IHY
 | |
4IHX
 | |
4IHV
 | |
4IHW
 | |
6DGB
 | | Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase | | Descriptor: | IS607 family transposase IS1535 | | Authors: | Chen, W.Y, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.52 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
