5SV0
| Structure of the ExbB/ExbD complex from E. coli at pH 7.0 | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, Biopolymer transport protein ExbB, CALCIUM ION | Authors: | Celia, H, Botos, I, Lloubes, R, Buchanan, S.K, Noinaj, N. | Deposit date: | 2016-08-04 | Release date: | 2016-09-28 | Last modified: | 2019-12-11 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structural insight into the role of the Ton complex in energy transduction. Nature, 538, 2016
|
|
3K85
| |
3K9E
| |
3JY6
| Crystal structure of LacI Transcriptional regulator from Lactobacillus brevis | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, Transcriptional regulator, ... | Authors: | Syed Ibrahim, B, Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | Deposit date: | 2009-09-21 | Release date: | 2009-10-13 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.97 Å) | Cite: | Crystal structure of LacI Transcriptional regulator from Lactobacillus brevis To be Published
|
|
3OMH
| Crystal structure of PTPN22 in complex with SKAP-HOM pTyr75 peptide | Descriptor: | Src kinase-associated phosphoprotein 2, Tyrosine-protein phosphatase non-receptor type 22 | Authors: | Yu, X, Sun, J.-P, Zhang, S, Zhang, Z.-Y. | Deposit date: | 2010-08-26 | Release date: | 2011-06-29 | Last modified: | 2011-09-14 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Substrate Specificity of Lymphoid-specific Tyrosine Phosphatase (Lyp) and Identification of Src Kinase-associated Protein of 55 kDa Homolog (SKAP-HOM) as a Lyp Substrate. J.Biol.Chem., 286, 2011
|
|
1KG9
| Structure of a "mock-trapped" early-M intermediate of bacteriorhosopsin | Descriptor: | 1-[2,6,10.14-TETRAMETHYL-HEXADECAN-16-YL]-2-[2,10,14-TRIMETHYLHEXADECAN-16-YL]GLYCEROL, RETINAL, bacteriorhodopsin | Authors: | Facciotti, M.T, Rouhani, S, Burkard, F.T, Betancourt, F.M, Downing, K.H, Rose, R.B, McDermott, G, Glaeser, R.M. | Deposit date: | 2001-11-26 | Release date: | 2001-12-05 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.81 Å) | Cite: | Structure of an early intermediate in the M-state phase of the bacteriorhodopsin photocycle. Biophys.J., 81, 2001
|
|
2PZZ
| |
4JR8
| |
4OHE
| LEOPARD Syndrome-Associated SHP2/G464A mutant | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | Deposit date: | 2014-01-17 | Release date: | 2014-09-24 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.506 Å) | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations. Biochemistry, 53, 2014
|
|
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
2QS8
| Crystal structure of a Xaa-Pro dipeptidase with bound methionine in the active site | Descriptor: | MAGNESIUM ION, METHIONINE, Xaa-Pro Dipeptidase | Authors: | Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | Deposit date: | 2007-07-30 | Release date: | 2007-08-21 | Last modified: | 2021-02-03 | Method: | X-RAY DIFFRACTION (2.33 Å) | Cite: | Functional annotation of two new carboxypeptidases from the amidohydrolase superfamily of enzymes. Biochemistry, 48, 2009
|
|
3L4A
| |
2QVC
| Crystal structure of a periplasmic sugar ABC transporter from Thermotoga maritima | Descriptor: | Sugar ABC transporter, periplasmic sugar-binding protein, beta-D-glucopyranose | Authors: | Palani, K, Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | Deposit date: | 2007-08-08 | Release date: | 2007-08-28 | Last modified: | 2021-02-03 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of a periplasmic glucose-binding protein from Thermotoga maritima. Acta Crystallogr.,Sect.F, 68, 2012
|
|
2QZJ
| |
4OHD
| LEOPARD Syndrome-Associated SHP2/A461T mutant | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | Deposit date: | 2014-01-17 | Release date: | 2014-09-24 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations. Biochemistry, 53, 2014
|
|
2QQ6
| |
5XVQ
| Crystal structure of monkey Nicotinamide N-methyltransferase (NNMT) bound with end product, 1-methyl Nicotinamide (MNA) | Descriptor: | 3-carbamoyl-1-methylpyridin-1-ium, GLYCEROL, Nicotinamide N-methyltransferase (NNMT), ... | Authors: | Birudukota, S, Swaminathan, S, Thakur, M.K, Parveen, R, Kandan, S, Kannt, A, Gosu, R. | Deposit date: | 2017-06-28 | Release date: | 2017-08-02 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.29 Å) | Cite: | Crystal structures of monkey and mouse nicotinamide N-methyltransferase (NNMT) bound with end product, 1-methyl nicotinamide Biochem. Biophys. Res. Commun., 491, 2017
|
|
4OHL
| LEOPARD Syndrome-Associated SHP2/T468M mutant | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | Deposit date: | 2014-01-17 | Release date: | 2014-09-24 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations. Biochemistry, 53, 2014
|
|
2QVG
| |
2QXY
| |
2QYG
| Crystal Structure of a RuBisCO-like Protein rlp2 from Rhodopseudomonas palustris | Descriptor: | Ribulose bisphosphate carboxylase-like protein 2 | Authors: | Li, H, Chan, S, Tabita, F.R, Eisenberg, D. | Deposit date: | 2007-08-14 | Release date: | 2007-09-11 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Function, structure, and evolution of the RubisCO-like proteins and their RubisCO homologs. Microbiol.Mol.Biol.Rev., 71, 2007
|
|
4OHH
| LEOPARD Syndrome-Associated SHP2/Q506P mutant | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | Deposit date: | 2014-01-17 | Release date: | 2014-09-24 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations. Biochemistry, 53, 2014
|
|
5T1O
| Solution-state NMR and SAXS structural ensemble of NPr (1-85) in complex with EIN-Ntr (170-424) | Descriptor: | Phosphocarrier protein NPr, Phosphoenolpyruvate-protein phosphotransferase PtsP | Authors: | Strickland, M, Stanley, A.M, Wang, G, Schwieters, C.D, Buchanan, S, Peterkofsky, A, Tjandra, N. | Deposit date: | 2016-08-19 | Release date: | 2016-11-16 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR, SOLUTION SCATTERING | Cite: | Structure of the NPr:EIN(Ntr) Complex: Mechanism for Specificity in Paralogous Phosphotransferase Systems. Structure, 24, 2016
|
|
2GVC
| Crystal structure of flavin-containing monooxygenase (FMO)from S.pombe and substrate (methimazole) complex | Descriptor: | 1-METHYL-1,3-DIHYDRO-2H-IMIDAZOLE-2-THIONE, FLAVIN-ADENINE DINUCLEOTIDE, GLYCEROL, ... | Authors: | Eswaramoorthy, S, Swaminathan, S, Burley, S.K, New York SGX Research Center for Structural Genomics (NYSGXRC) | Deposit date: | 2006-05-02 | Release date: | 2006-06-06 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.22 Å) | Cite: | Mechanism of action of a flavin-containing monooxygenase. Proc.Natl.Acad.Sci.Usa, 103, 2006
|
|
4L35
| |