5SV0
 
 | | Structure of the ExbB/ExbD complex from E. coli at pH 7.0 | | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, Biopolymer transport protein ExbB, CALCIUM ION | | Authors: | Celia, H, Botos, I, Lloubes, R, Buchanan, S.K, Noinaj, N. | | Deposit date: | 2016-08-04 | | Release date: | 2016-09-28 | | Last modified: | 2019-12-11 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural insight into the role of the Ton complex in energy transduction.
Nature, 538, 2016
|
|
3K85
 | |
3K9E
 | |
3JY6
 | | Crystal structure of LacI Transcriptional regulator from Lactobacillus brevis | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, Transcriptional regulator, ... | | Authors: | Syed Ibrahim, B, Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2009-09-21 | | Release date: | 2009-10-13 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.97 Å) | | Cite: | Crystal structure of LacI Transcriptional regulator from Lactobacillus brevis
To be Published
|
|
3OMH
 | | Crystal structure of PTPN22 in complex with SKAP-HOM pTyr75 peptide | | Descriptor: | Src kinase-associated phosphoprotein 2, Tyrosine-protein phosphatase non-receptor type 22 | | Authors: | Yu, X, Sun, J.-P, Zhang, S, Zhang, Z.-Y. | | Deposit date: | 2010-08-26 | | Release date: | 2011-06-29 | | Last modified: | 2011-09-14 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Substrate Specificity of Lymphoid-specific Tyrosine Phosphatase (Lyp) and Identification of Src Kinase-associated Protein of 55 kDa Homolog (SKAP-HOM) as a Lyp Substrate.
J.Biol.Chem., 286, 2011
|
|
1KG9
 | | Structure of a "mock-trapped" early-M intermediate of bacteriorhosopsin | | Descriptor: | 1-[2,6,10.14-TETRAMETHYL-HEXADECAN-16-YL]-2-[2,10,14-TRIMETHYLHEXADECAN-16-YL]GLYCEROL, RETINAL, bacteriorhodopsin | | Authors: | Facciotti, M.T, Rouhani, S, Burkard, F.T, Betancourt, F.M, Downing, K.H, Rose, R.B, McDermott, G, Glaeser, R.M. | | Deposit date: | 2001-11-26 | | Release date: | 2001-12-05 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.81 Å) | | Cite: | Structure of an early intermediate in the M-state phase of the bacteriorhodopsin photocycle.
Biophys.J., 81, 2001
|
|
2PZZ
 | |
4JR8
 | |
4OHE
 | | LEOPARD Syndrome-Associated SHP2/G464A mutant | | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | | Deposit date: | 2014-01-17 | | Release date: | 2014-09-24 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.506 Å) | | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations.
Biochemistry, 53, 2014
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
2QS8
 | | Crystal structure of a Xaa-Pro dipeptidase with bound methionine in the active site | | Descriptor: | MAGNESIUM ION, METHIONINE, Xaa-Pro Dipeptidase | | Authors: | Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2007-07-30 | | Release date: | 2007-08-21 | | Last modified: | 2021-02-03 | | Method: | X-RAY DIFFRACTION (2.33 Å) | | Cite: | Functional annotation of two new carboxypeptidases from the amidohydrolase superfamily of enzymes.
Biochemistry, 48, 2009
|
|
3L4A
 | |
2QVC
 | | Crystal structure of a periplasmic sugar ABC transporter from Thermotoga maritima | | Descriptor: | Sugar ABC transporter, periplasmic sugar-binding protein, beta-D-glucopyranose | | Authors: | Palani, K, Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2007-08-08 | | Release date: | 2007-08-28 | | Last modified: | 2021-02-03 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure of a periplasmic glucose-binding protein from Thermotoga maritima.
Acta Crystallogr.,Sect.F, 68, 2012
|
|
2QZJ
 | |
4OHD
 | | LEOPARD Syndrome-Associated SHP2/A461T mutant | | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | | Deposit date: | 2014-01-17 | | Release date: | 2014-09-24 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations.
Biochemistry, 53, 2014
|
|
2QQ6
 | |
5XVQ
 | | Crystal structure of monkey Nicotinamide N-methyltransferase (NNMT) bound with end product, 1-methyl Nicotinamide (MNA) | | Descriptor: | 3-carbamoyl-1-methylpyridin-1-ium, GLYCEROL, Nicotinamide N-methyltransferase (NNMT), ... | | Authors: | Birudukota, S, Swaminathan, S, Thakur, M.K, Parveen, R, Kandan, S, Kannt, A, Gosu, R. | | Deposit date: | 2017-06-28 | | Release date: | 2017-08-02 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.29 Å) | | Cite: | Crystal structures of monkey and mouse nicotinamide N-methyltransferase (NNMT) bound with end product, 1-methyl nicotinamide
Biochem. Biophys. Res. Commun., 491, 2017
|
|
4OHL
 | | LEOPARD Syndrome-Associated SHP2/T468M mutant | | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | | Deposit date: | 2014-01-17 | | Release date: | 2014-09-24 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations.
Biochemistry, 53, 2014
|
|
2QVG
 | |
2QXY
 | |
2QYG
 | | Crystal Structure of a RuBisCO-like Protein rlp2 from Rhodopseudomonas palustris | | Descriptor: | Ribulose bisphosphate carboxylase-like protein 2 | | Authors: | Li, H, Chan, S, Tabita, F.R, Eisenberg, D. | | Deposit date: | 2007-08-14 | | Release date: | 2007-09-11 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Function, structure, and evolution of the RubisCO-like proteins and their RubisCO homologs.
Microbiol.Mol.Biol.Rev., 71, 2007
|
|
4OHH
 | | LEOPARD Syndrome-Associated SHP2/Q506P mutant | | Descriptor: | Tyrosine-protein phosphatase non-receptor type 11 | | Authors: | Yu, Z.H, Zhang, R.Y, Walls, C.D, Chen, L, Zhang, S, Wu, L, Wang, L, Liu, S, Zhang, Z.Y. | | Deposit date: | 2014-01-17 | | Release date: | 2014-09-24 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Molecular basis of gain-of-function LEOPARD syndrome-associated SHP2 mutations.
Biochemistry, 53, 2014
|
|
5T1O
 | | Solution-state NMR and SAXS structural ensemble of NPr (1-85) in complex with EIN-Ntr (170-424) | | Descriptor: | Phosphocarrier protein NPr, Phosphoenolpyruvate-protein phosphotransferase PtsP | | Authors: | Strickland, M, Stanley, A.M, Wang, G, Schwieters, C.D, Buchanan, S, Peterkofsky, A, Tjandra, N. | | Deposit date: | 2016-08-19 | | Release date: | 2016-11-16 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR, SOLUTION SCATTERING | | Cite: | Structure of the NPr:EIN(Ntr) Complex: Mechanism for Specificity in Paralogous Phosphotransferase Systems.
Structure, 24, 2016
|
|
2GVC
 | | Crystal structure of flavin-containing monooxygenase (FMO)from S.pombe and substrate (methimazole) complex | | Descriptor: | 1-METHYL-1,3-DIHYDRO-2H-IMIDAZOLE-2-THIONE, FLAVIN-ADENINE DINUCLEOTIDE, GLYCEROL, ... | | Authors: | Eswaramoorthy, S, Swaminathan, S, Burley, S.K, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2006-05-02 | | Release date: | 2006-06-06 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.22 Å) | | Cite: | Mechanism of action of a flavin-containing monooxygenase.
Proc.Natl.Acad.Sci.Usa, 103, 2006
|
|
4L35
 | |
