4KGG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kgg by Molmil](/molmil-images/mine/4kgg) | Crystal structure of light mutant2 and dcr3 complex | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, MAGNESIUM ION, Tumor necrosis factor ligand superfamily member 14, ... | Authors: | Liu, W, Bonanno, J.B, Zhan, C, Kumar, P.R, Toro, R, Nathenson, S.G, Almo, S.C, Atoms-to-Animals: The Immune Function Network (IFN), New York Structural Genomics Research Consortium (NYSGRC) | Deposit date: | 2013-04-29 | Release date: | 2013-08-07 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.78 Å) | Cite: | Mechanistic basis for functional promiscuity in the TNF and TNF receptor superfamilies: structure of the LIGHT:DcR3 assembly. Structure, 22, 2014
|
|
2L6G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2l6g by Molmil](/molmil-images/mine/2l6g) | |
4DDR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ddr by Molmil](/molmil-images/mine/4ddr) | Human dihydrofolate reductase complexed with NADPH and P218 | Descriptor: | 3-(2-{3-[(2,4-diamino-6-ethylpyrimidin-5-yl)oxy]propoxy}phenyl)propanoic acid, Dihydrofolate reductase, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | Authors: | Yuthavong, Y, Tarnchompoo, B, Vilaivan, T, Chitnumsub, P, Kamchonwongpaisan, S, Charman, S.A, McLennan, D.N, White, K.L, Vivas, L, Bongard, E, Thongphanchang, C, Taweechai, S, Vanichtanankul, J, Rattanajak, R, Arwon, U, Fantauzzi, P, Yuvaniyama, J, Charman, W.N, Matthews, D. | Deposit date: | 2012-01-19 | Release date: | 2012-11-14 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Malarial dihydrofolate reductase as a paradigm for drug development against a resistance-compromised target Proc.Natl.Acad.Sci.USA, 109, 2012
|
|
5RAJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5raj by Molmil](/molmil-images/mine/5raj) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with BD009815a | Descriptor: | 2,4-dichloro-N-(pyridin-3-yl)benzamide, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.61 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb1 by Molmil](/molmil-images/mine/5rb1) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001700a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
2O2T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2o2t by Molmil](/molmil-images/mine/2o2t) | The crystal structure of the 1st PDZ domain of MPDZ | Descriptor: | Multiple PDZ domain protein | Authors: | Papagrigoriou, E, Gileadi, C, Phillips, C, Johansson, C, Salah, E, Savitsky, P, Gorrec, F, Umeano, C, Berridge, G, Pike, A.C.W, Elkins, J, Edwards, A, Arrowsmith, C, Weigelt, J, Sundstrom, M, Doyle, D.A, Structural Genomics Consortium (SGC) | Deposit date: | 2006-11-30 | Release date: | 2006-12-12 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | The crystal structure of the 1st PDZ domain of MPDZ To be Published
|
|
5RAK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rak by Molmil](/molmil-images/mine/5rak) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS040486b | Descriptor: | 3-(pyridin-3-yl)aniline, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.69 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rax by Molmil](/molmil-images/mine/5rax) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM010054a | Descriptor: | 2-(2-methoxyphenoxy)ethanehydrazide, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2.01 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rai by Molmil](/molmil-images/mine/5rai) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS040404c | Descriptor: | (1-methyl-5-phenyl-pyrazol-3-yl)methanol, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.54 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb3 by Molmil](/molmil-images/mine/5rb3) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS039249d | Descriptor: | 1-methyl-3-(thiophen-2-yl)-1H-pyrazol-5-amine, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.53 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ral by Molmil](/molmil-images/mine/5ral) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS039332c | Descriptor: | 5-azanyl-2-pyrrol-1-yl-benzenecarbonitrile, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.68 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb2 by Molmil](/molmil-images/mine/5rb2) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001784a | Descriptor: | 2-methyl-1,3-benzoxazol-6-ol, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.52 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rag by Molmil](/molmil-images/mine/5rag) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001767a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.52 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5raw by Molmil](/molmil-images/mine/5raw) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM009970a | Descriptor: | 1-{4-[(2-methoxyethyl)amino]piperidin-1-yl}ethan-1-one, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
4KGQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kgq by Molmil](/molmil-images/mine/4kgq) | Crystal structure of a human light loop mutant in complex with dcr3 | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, MAGNESIUM ION, Tumor necrosis factor ligand superfamily member 14, ... | Authors: | Liu, W, Zhan, C, Bonanno, J.B, Sampathkumar, P, Toro, R, Nathenson, S.G, Almo, S.C, New York Structural Genomics Research Consortium (NYSGRC), Atoms-to-Animals: The Immune Function Network (IFN) | Deposit date: | 2013-04-29 | Release date: | 2013-07-10 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.27 Å) | Cite: | Mechanistic basis for functional promiscuity in the TNF and TNF receptor superfamilies: structure of the LIGHT:DcR3 assembly. Structure, 22, 2014
|
|
4DP3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4dp3 by Molmil](/molmil-images/mine/4dp3) | Quadruple mutant (N51I+C59R+S108N+I164L) plasmodium falciparum dihydrofolate reductase-thymidylate synthase (PfDHFR-TS) complexed with P218 and NADPH | Descriptor: | 3-(2-{3-[(2,4-diamino-6-ethylpyrimidin-5-yl)oxy]propoxy}phenyl)propanoic acid, Bifunctional dihydrofolate reductase-thymidylate synthase, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | Authors: | Yuthavong, Y, Vilaivan, T, Kamchonwongpaisan, S, Charman, S.A, McLennan, D.N, White, K.L, Vivas, L, Bongard, E, Chitnumsub, P, Tarnchompoo, B, Thongphanchang, C, Taweechai, S, Vanichtanakul, J, Arwon, U, Fantauzzi, P, Yuvaniyama, J, Charman, W.N, Matthews, D. | Deposit date: | 2012-02-13 | Release date: | 2012-11-14 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Malarial dihydrofolate reductase as a paradigm for drug development against a resistance-compromised target Proc.Natl.Acad.Sci.USA, 109, 2012
|
|
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
5RAN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ran by Molmil](/molmil-images/mine/5ran) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with XS039080d | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.95 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb4 by Molmil](/molmil-images/mine/5rb4) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001677a | Descriptor: | 2-[4-(3-chlorophenyl)piperazin-1-ium-1-yl]ethanenitrile, CHLORIDE ION, Lysine-specific demethylase 3B, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.55 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RAO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rao by Molmil](/molmil-images/mine/5rao) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM001084a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.59 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
5RB5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5rb5 by Molmil](/molmil-images/mine/5rb5) | PanDDA analysis group deposition -- Crystal Structure of JMJD1B in complex with FM010010a | Descriptor: | CHLORIDE ION, Lysine-specific demethylase 3B, MANGANESE (II) ION, ... | Authors: | Snee, M, Nowak, R, Johansson, C, Burgess-Brown, N.A, Arrowsmith, C.H, Bountra, C, Edwards, A.M, Oppermann, U. | Deposit date: | 2020-03-16 | Release date: | 2020-04-22 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (1.51 Å) | Cite: | PanDDA analysis group deposition of Human JMJD1B screened against the DSPL Fragment Library To Be Published
|
|
4DPH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4dph by Molmil](/molmil-images/mine/4dph) | Quadruple mutant (N51I+C59R+S108N+I164L) Plasmodium falciparum dihydrofolate reductase-thymidylate synthase (PfDHFR-TS) complexed with P65 and NADPH | Descriptor: | 2,4-diamino-6-methyl-5-[3-(2,4,5-trichlorophenoxy)propyloxy]pyrimidine, BETA-MERCAPTOETHANOL, Bifunctional dihydrofolate reductase-thymidylate synthase, ... | Authors: | Yuthavong, Y, Vilaivan, T, Kamchonwongpaisan, S, Charman, S.A, McLennan, D.N, White, K.L, Vivas, L, Bongard, E, Chitnumsub, P, Tarnchompoo, B, Thongphanchang, C, Taweechai, S, Vanichtanakul, J, Arwon, U, Fantauzzi, P, Yuvaniyama, J, Charman, W.N, Matthews, D. | Deposit date: | 2012-02-13 | Release date: | 2012-11-14 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.38 Å) | Cite: | Malarial dihydrofolate reductase as a paradigm for drug development against a resistance-compromised target Proc.Natl.Acad.Sci.USA, 109, 2012
|
|
4MSV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4msv by Molmil](/molmil-images/mine/4msv) | Crystal structure of FASL and DcR3 complex | Descriptor: | GLYCEROL, MAGNESIUM ION, Tumor necrosis factor ligand superfamily member 6, ... | Authors: | Liu, W, Ramagopal, U.A, Zhan, C, Bonanno, J.B, Bhosle, R.C, Nathenson, S.G, Almo, S.C, Atoms-to-Animals: The Immune Function Network (IFN), New York Structural Genomics Research Consortium (NYSGRC) | Deposit date: | 2013-09-18 | Release date: | 2013-11-27 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal Structure of the Complex of Human FasL and Its Decoy Receptor DcR3. Structure, 24, 2016
|
|
2J8Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2j8z by Molmil](/molmil-images/mine/2j8z) | Crystal Structure of human P53 inducible oxidoreductase (TP53I3,PIG3) | Descriptor: | NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, QUINONE OXIDOREDUCTASE | Authors: | Pike, A.C.W, Shafqat, N, Debreczeni, J, Johansson, C, Haroniti, A, Gileadi, O, Arrowsmith, C.H, Edwards, A, Weigelt, J, Sundstrom, M, von Delft, F, Porte, S, Fita, I, Pares, J, Pares, X, Oppermann, U. | Deposit date: | 2006-10-31 | Release date: | 2006-11-06 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Three-Dimensional Structure and Enzymatic Function of Proapoptotic Human P53-Inducible Quinone Oxidoreductase Pig3. J.Biol.Chem., 284, 2009
|
|
2A61
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2a61 by Molmil](/molmil-images/mine/2a61) | The crystal structure of transcriptional regulator Tm0710 from Thermotoga maritima | Descriptor: | transcriptional regulator Tm0710 | Authors: | Lunin, V.V, Evdokimova, E, Kudritska, M, Chang, C, Joachimiak, A, Edwards, A, Savchenko, A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2005-07-01 | Release date: | 2005-07-19 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | The crystal structure of transcriptional regulator Tm0710 from Thermotoga maritima To be Published
|
|