1KX5
 
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
7COW
 | | 353 bp di-nucleosome harboring cohesive DNA termini with linker histone H1.0 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (353-MER), ... | | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | | Deposit date: | 2020-08-05 | | Release date: | 2021-08-11 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.86 Å) | | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies.
Nucleic Acids Res., 49, 2021
|
|
4WU9
 | | Structure of cisPtNAP-NCP145 | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Davey, G.E, Chin, C.F, Droge, P, Ang, W.H, Davey, C.A. | | Deposit date: | 2014-10-31 | | Release date: | 2015-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents.
Nucleic Acids Res., 43, 2015
|
|
5XF3
 | | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,R-configuration) | | Descriptor: | (1R,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2017-04-07 | | Release date: | 2017-10-11 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation
Nat Commun, 8, 2017
|
|
5XF5
 | | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,S-configuration) | | Descriptor: | (1S,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2017-04-07 | | Release date: | 2017-10-11 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.82 Å) | | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation
Nat Commun, 8, 2017
|
|
5XF6
 | | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2017-04-07 | | Release date: | 2017-10-11 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation
Nat Commun, 8, 2017
|
|
5XF4
 | | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (S,S-configuration) | | Descriptor: | (1S,2S)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2017-04-07 | | Release date: | 2017-10-11 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.87 Å) | | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation
Nat Commun, 8, 2017
|
|
6LAB
 | | 169 bp nucleosome, harboring cohesive DNA termini, assembled with linker histone H1.0 | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | | Authors: | Adhireksan, Z, Sharma, D, Bao, Q, Lee, P.L, Padavattan, S, Davey, C.A. | | Deposit date: | 2019-11-12 | | Release date: | 2021-02-17 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies.
Nucleic Acids Res., 49, 2021
|
|
4WU8
 | | Structure of trPtNAP-NCP145 | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Davey, C.A. | | Deposit date: | 2014-10-31 | | Release date: | 2015-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents.
Nucleic Acids Res., 43, 2015
|
|
6L9Z
 | | 338 bp di-nucleosome assembled with linker histone H1.X | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (338-MER), ... | | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | | Deposit date: | 2019-11-11 | | Release date: | 2021-02-17 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies.
Nucleic Acids Res., 49, 2021
|
|
6LA2
 | | 343 bp di-nucleosome harboring cohesive DNA termini assembled with linker histone H1.0 | | Descriptor: | DNA (343-MER), Histone H1.0, Histone H2A type 1-B/E, ... | | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | | Deposit date: | 2019-11-11 | | Release date: | 2021-02-17 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (3.89 Å) | | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies.
Nucleic Acids Res., 49, 2021
|
|
6LER
 | | 169 bp nucleosome harboring non-identical cohesive DNA termini. | | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H2A type 1-B/E, ... | | Authors: | Sharma, D, Adhireksan, Z, Lee, P.L, Davey, C.A. | | Deposit date: | 2019-11-26 | | Release date: | 2021-03-03 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies.
Nucleic Acids Res., 49, 2021
|
|
8YTI
 | | Crystal Structure of Nucleosome-H1x Linker Histone Assembly (sticky-169a DNA fragment) | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | | Authors: | Adhireksan, Z, Qiuye, B, Padavattan, S, Davey, C.A. | | Deposit date: | 2024-03-26 | | Release date: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Linker Histones Associate Heterogeneously with Nucleosomes in the Condensed State
To Be Published
|
|
8QKT
 | |
3B6F
 | |
3B6G
 | |
7XX6
 | | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) | | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.0, ... | | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | | Deposit date: | 2022-05-28 | | Release date: | 2023-05-31 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (3.39 Å) | | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment)
To Be Published
|
|
7XVM
 | | Crystal Structure of Nucleosome-H5 Linker Histone Assembly (sticky-169a DNA fragment) | | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | | Deposit date: | 2022-05-24 | | Release date: | 2023-05-24 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.84 Å) | | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment)
To Be Published
|
|
7XX5
 | | Crystal Structure of Nucleosome-H1.3 Linker Histone Assembly (sticky-169a DNA fragment) | | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.3, ... | | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | | Deposit date: | 2022-05-28 | | Release date: | 2023-05-31 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (3.19 Å) | | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment)
To Be Published
|
|
2IIE
 | | single chain Integration Host Factor protein (scIHF2) in complex with DNA | | Descriptor: | DNA (5'-D(*DGP*DCP*DTP*DTP*DAP*DTP*DCP*DAP*DAP*DTP*DTP*DTP*DGP*DTP*DTP*DGP*DCP*DAP*DCP*DC)-3'), DNA (5'-D(*DGP*DGP*DCP*DCP*DAP*DAP*DAP*DAP*DAP*DAP*DGP*DCP*DAP*DTP*DT)-3'), Integration host factor, ... | | Authors: | Bao, Q, Droege, P, Davey, C.A. | | Deposit date: | 2006-09-28 | | Release date: | 2007-02-20 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.41 Å) | | Cite: | A Divalent Metal-mediated Switch Controlling Protein-induced DNA Bending
J.Mol.Biol., 367, 2007
|
|
2IIF
 | | single chain Integration Host Factor mutant protein (scIHF2-K45aE) in complex with DNA | | Descriptor: | DNA (5'-D(*DGP*DCP*DTP*DTP*DAP*DTP*DCP*DAP*DAP*DTP*DTP*DTP*DGP*DTP*DTP*DGP*DCP*DAP*DCP*DC)-3'), DNA (5'-D(*DGP*DGP*DCP*DCP*DAP*DAP*DAP*DAP*DAP*DAP*DGP*DCP*DAP*DTP*DT)-3'), Integration host factor, ... | | Authors: | Bao, Q, Droege, P, Davey, C.A. | | Deposit date: | 2006-09-28 | | Release date: | 2007-02-20 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (2.72 Å) | | Cite: | A Divalent Metal-mediated Switch Controlling Protein-induced DNA Bending
J.Mol.Biol., 367, 2007
|
|
5CP6
 | | Nucleosome Core Particle with Adducts from the Anticancer Compound, [(eta6-5,8,9,10-tetrahydroanthracene)Ru(ethylenediamine)Cl][PF6] | | Descriptor: | (ethane6-5,8,9,10-tetrahydroanthracene)Ru(II)(ethylene-diamine)Cl, DNA (145-MER), Histone H2A, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2015-07-21 | | Release date: | 2016-06-01 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | An Organometallic Compound which Exhibits a DNA Topology-Dependent One-Stranded Intercalation Mode.
Angew.Chem.Int.Ed.Engl., 55, 2016
|
|
5DNN
 | | Nucleosome core particle containing adducts of gold(I)-triethylphosphane and ruthenium(II)-toluene PTA complexes | | Descriptor: | DNA (145-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Adhireksan, Z, Ma, Z, Davey, C.A. | | Deposit date: | 2015-09-10 | | Release date: | 2016-09-14 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Allosteric cross-talk in chromatin can mediate drug-drug synergy
Nat Commun, 8, 2017
|
|
