1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
6LAB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6lab by Molmil](/molmil-images/mine/6lab) | 169 bp nucleosome, harboring cohesive DNA termini, assembled with linker histone H1.0 | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Sharma, D, Bao, Q, Lee, P.L, Padavattan, S, Davey, C.A. | Deposit date: | 2019-11-12 | Release date: | 2021-02-17 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
6L9Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6l9z by Molmil](/molmil-images/mine/6l9z) | 338 bp di-nucleosome assembled with linker histone H1.X | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (338-MER), ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2019-11-11 | Release date: | 2021-02-17 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
6LA2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6la2 by Molmil](/molmil-images/mine/6la2) | 343 bp di-nucleosome harboring cohesive DNA termini assembled with linker histone H1.0 | Descriptor: | DNA (343-MER), Histone H1.0, Histone H2A type 1-B/E, ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2019-11-11 | Release date: | 2021-02-17 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (3.89 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
6LER
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ler by Molmil](/molmil-images/mine/6ler) | 169 bp nucleosome harboring non-identical cohesive DNA termini. | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H2A type 1-B/E, ... | Authors: | Sharma, D, Adhireksan, Z, Lee, P.L, Davey, C.A. | Deposit date: | 2019-11-26 | Release date: | 2021-03-03 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
5XF6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf6 by Molmil](/molmil-images/mine/5xf6) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.63 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf4 by Molmil](/molmil-images/mine/5xf4) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (S,S-configuration) | Descriptor: | (1S,2S)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.87 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf3 by Molmil](/molmil-images/mine/5xf3) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,R-configuration) | Descriptor: | (1R,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
5XF5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xf5 by Molmil](/molmil-images/mine/5xf5) | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having a 1,2-diphenylethylenediamine linker (R,S-configuration) | Descriptor: | (1S,2R)-1,2-diphenylethane-1,2-diamine, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | Deposit date: | 2017-04-07 | Release date: | 2017-10-11 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.82 Å) | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation Nat Commun, 8, 2017
|
|
8YTI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8yti by Molmil](/molmil-images/mine/8yti) | Crystal Structure of Nucleosome-H1x Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Padavattan, S, Davey, C.A. | Deposit date: | 2024-03-26 | Release date: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Linker Histones Associate Heterogeneously with Nucleosomes in the Condensed State To Be Published
|
|
3B6F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3b6f by Molmil](/molmil-images/mine/3b6f) | |
3B6G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3b6g by Molmil](/molmil-images/mine/3b6g) | |
7COW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7cow by Molmil](/molmil-images/mine/7cow) | 353 bp di-nucleosome harboring cohesive DNA termini with linker histone H1.0 | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (353-MER), ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2020-08-05 | Release date: | 2021-08-11 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Engineering nucleosomes for generating diverse chromatin assemblies. Nucleic Acids Res., 49, 2021
|
|
7XX6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xx6 by Molmil](/molmil-images/mine/7xx6) | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.0, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.39 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XVM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xvm by Molmil](/molmil-images/mine/7xvm) | Crystal Structure of Nucleosome-H5 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, CHLORIDE ION, DNA (169-MER), ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.84 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
7XX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xx5 by Molmil](/molmil-images/mine/7xx5) | Crystal Structure of Nucleosome-H1.3 Linker Histone Assembly (sticky-169a DNA fragment) | Descriptor: | CALCIUM ION, DNA (169-MER), Histone H1.3, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-28 | Release date: | 2023-05-31 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (3.19 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169a DNA fragment) To Be Published
|
|
6LA9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6la9 by Molmil](/molmil-images/mine/6la9) | 349 bp di-nucleosome harboring cohesive DNA termini assembled with linker histone H1.0 (high cryoprotectant) | Descriptor: | CALCIUM ION, DNA (349-MER), Histone H1.0, ... | Authors: | Adhireksan, Z, Sharma, D, Lee, P.L, Davey, C.A. | Deposit date: | 2019-11-12 | Release date: | 2020-10-07 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (3.7 Å) | Cite: | Near-atomic resolution structures of interdigitated nucleosome fibres. Nat Commun, 11, 2020
|
|
7XVL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7xvl by Molmil](/molmil-images/mine/7xvl) | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169an DNA fragment) | Descriptor: | DNA (169-MER), Histone H1.0, Histone H2A type 1-B/E, ... | Authors: | Adhireksan, Z, Qiuye, B, Lee, P.L, Sharma, D, Padavattan, S, Davey, C.A. | Deposit date: | 2022-05-24 | Release date: | 2023-05-24 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (3.506 Å) | Cite: | Crystal Structure of Nucleosome-H1.0 Linker Histone Assembly (sticky-169an DNA fragment) To Be Published
|
|
8QKT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8qkt by Molmil](/molmil-images/mine/8qkt) | |
3LZ1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lz1 by Molmil](/molmil-images/mine/3lz1) | Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 2) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|
3LZ0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3lz0 by Molmil](/molmil-images/mine/3lz0) | Crystal Structure of Nucleosome Core Particle Composed of the Widom 601 DNA Sequence (orientation 1) | Descriptor: | CHLORIDE ION, DNA (145-MER), Histone H2A, ... | Authors: | Vasudevan, D, Chua, E.Y.D, Davey, C.A. | Deposit date: | 2010-03-01 | Release date: | 2010-09-15 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Crystal structures of nucleosome core particles containing the '601' strong positioning sequence J.Mol.Biol., 403, 2010
|
|
3MGR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mgr by Molmil](/molmil-images/mine/3mgr) | Binding of Rubidium ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|
3MGP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mgp by Molmil](/molmil-images/mine/3mgp) | Binding of Cobalt ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, COBALT (II) ION, DNA (147-MER), ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.44 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|