1PCA
 
 | | THREE DIMENSIONAL STRUCTURE OF PORCINE PANCREATIC PROCARBOXYPEPTIDASE A. A COMPARISON OF THE A AND B ZYMOGENS AND THEIR DETERMINANTS FOR INHIBITION AND ACTIVATION | | Descriptor: | CITRIC ACID, PROCARBOXYPEPTIDASE A PCPA, VALINE, ... | | Authors: | Guasch, A, Coll, M, Aviles, F.X, Huber, R. | | Deposit date: | 1991-10-28 | | Release date: | 1993-10-31 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Three-dimensional structure of porcine pancreatic procarboxypeptidase A. A comparison of the A and B zymogens and their determinants for inhibition and activation.
J.Mol.Biol., 224, 1992
|
|
1JVW
 | | TRYPANOSOMA CRUZI MACROPHAGE INFECTIVITY POTENTIATOR (TCMIP) | | Descriptor: | MACROPHAGE INFECTIVITY POTENTIATOR | | Authors: | Pereira, P.J.B, Vega, M.C, Gonzalez-Rey, E, Fernandez-Carazo, R, Macedo-Ribeiro, S, Gomis-Rueth, F.X, Gonzalez, A, Coll, M. | | Deposit date: | 2001-08-31 | | Release date: | 2002-06-05 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Trypanosoma cruzi macrophage infectivity potentiator has a rotamase core and a highly exposed alpha-helix.
EMBO Rep., 3, 2002
|
|
2IYN
 | | The co-factor-induced pre-active conformation in PhoB | | Descriptor: | MAGNESIUM ION, PHOSPHATE REGULON TRANSCRIPTIONAL REGULATORY PROTEIN PHOB | | Authors: | Sola, M, Drew, D.L, Blanco, A.G, Gomis-Ruth, F.X, Coll, M. | | Deposit date: | 2006-07-19 | | Release date: | 2006-08-30 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.08 Å) | | Cite: | The Cofactor-Induced Pre-Active Conformation in Phob.
Acta Crystallogr.,Sect.D, 62, 2006
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
1S6M
 | | Conjugative Relaxase Trwc In Complex With Orit DNA. Metal-Bound Structure | | Descriptor: | DNA (25-MER), NICKEL (II) ION, TrwC | | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Perez-Luque, R, Gomis-Ruth, F.X, de la Cruz, F, Coll, M. | | Deposit date: | 2004-01-26 | | Release date: | 2005-06-14 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.28 Å) | | Cite: | Unveiling the molecular mechanism of a conjugative relaxase: The structure of TrwC complexed with a 27-mer DNA comprising the recognition hairpin and the cleavage site.
J.Mol.Biol., 358, 2006
|
|
1RNF
 | | X-RAY CRYSTAL STRUCTURE OF UNLIGANDED HUMAN RIBONUCLEASE 4 | | Descriptor: | PROTEIN (RIBONUCLEASE 4) | | Authors: | Terzyan, S.S, Peracaula, R, De Llorens, R, Tsushima, Y, Yamada, H, Seno, M, Gomis-Rueth, F.X, Coll, M. | | Deposit date: | 1998-10-29 | | Release date: | 1999-10-29 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The three-dimensional structure of human RNase 4, unliganded and complexed with d(Up), reveals the basis for its uridine selectivity.
J.Mol.Biol., 285, 1999
|
|
1NQ6
 | | Crystal Structure of the catalytic domain of xylanase A from Streptomyces halstedii JM8 | | Descriptor: | MAGNESIUM ION, Xys1 | | Authors: | Canals, A, Vega, M.C, Gomis-Ruth, F.X, Santamaria, R.I, Coll, M. | | Deposit date: | 2003-01-21 | | Release date: | 2004-01-21 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (1.78 Å) | | Cite: | Structure of xylanase Xys1delta from Streptomyces halstedii.
Acta Crystallogr.,Sect.D, 59, 2003
|
|
1ZM5
 | | Conjugative Relaxase TRWC in complex with ORIT dna, cooper-bound structure | | Descriptor: | COPPER (II) ION, DNA (25-MER), SULFATE ION, ... | | Authors: | Boer, R, Russi, S, Guasch, A, Lucas, M, Blanco, A.G, Coll, M, de la Cruz, F. | | Deposit date: | 2005-05-10 | | Release date: | 2006-04-25 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Unveiling the Molecular Mechanism of a Conjugative Relaxase: The Structure of TrwC Complexed with a 27-mer DNA Comprising the Recognition Hairpin and the Cleavage Site
J.Mol.Biol., 358, 2006
|
|
2GLR
 | |
1Z3F
 | | Structure of ellipticine in complex with a 6-bp DNA | | Descriptor: | 5'-D(*CP*GP*AP*TP*CP*G)-3', COBALT (II) ION, ELLIPTICINE | | Authors: | Canals, A, Purciolas, M, Aymami, J, Coll, M. | | Deposit date: | 2005-03-12 | | Release date: | 2005-07-19 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | The anticancer agent ellipticine unwinds DNA by intercalative binding in an orientation parallel to base pairs.
Acta Crystallogr.,Sect.D, 61, 2005
|
|
1GON
 | | b-glucosidase from Streptomyces sp | | Descriptor: | BETA-GLUCOSIDASE, MERCURY (II) ION, SULFATE ION | | Authors: | Guasch, A, Perez-Pons, J.A, Vallmitjana, M, Querol, E, Coll, M. | | Deposit date: | 2001-10-22 | | Release date: | 2002-11-07 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal Structure of a Family 1 Beta-Glucosidase from Streptomyces
To be Published
|
|
1GNX
 | | b-glucosidase from Streptomyces sp | | Descriptor: | BETA-GLUCOSIDASE, SULFATE ION, beta-D-fructofuranose-(2-1)-alpha-D-glucopyranose | | Authors: | Guasch, A, Perez-Pons, J.A, Vallmitjana, M, Querol, E, Coll, M. | | Deposit date: | 2001-10-10 | | Release date: | 2002-10-17 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.68 Å) | | Cite: | Beta-Glucosidase from Streptomyces
To be Published
|
|
2ET0
 | | The structure of a three-way DNA junction in complex with a metallo-supramolecular helicate reveals a new target for drugs | | Descriptor: | 5'-D(*CP*GP*TP*AP*CP*G)-3', FE (II) ION, N-[(1E)-PYRIDIN-2-YLMETHYLENE]-N-[4-(4-{[(1E)-PYRIDIN-2-YLMETHYLENE]AMINO}BENZYL)PHENYL]AMINE | | Authors: | Oleksi, A, Blanco, A.G, Boer, R, Uson, I, Aymami, J, Coll, M. | | Deposit date: | 2005-10-27 | | Release date: | 2006-03-14 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Molecular Recognition of a Three-Way DNA Junction by a Metallosupramolecular Helicate
ANGEW.CHEM.INT.ED.ENGL., 45, 2006
|
|
1OKR
 | | Three-dimensional structure of S.aureus methicillin-resistance regulating transcriptional repressor MecI. | | Descriptor: | CHLORIDE ION, GLYCEROL, METHICILLIN RESISTANCE REGULATORY PROTEIN MECI | | Authors: | Garcia-Castellanos, R, Marrero, A, Mallorqui-Fernandez, G, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2003-07-28 | | Release date: | 2003-10-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Three-Dimensional Structure of Meci: Molecular Basis for Transcriptional Regulation of Staphylococcal Methicillin Resistance
J.Biol.Chem., 278, 2003
|
|
2FIO
 | | Phage phi29 transcription regulator p4-DNA complex | | Descriptor: | DNA (41-MER), Late genes activator | | Authors: | Badia, D, Camacho, A, Perez-Lago, L, Escandon, C, Salas, M, Coll, M. | | Deposit date: | 2005-12-30 | | Release date: | 2006-09-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | The structure of phage phi29 transcription regulator p4-DNA complex reveals an N-hook motif for DNA
Mol.Cell, 22, 2006
|
|
2FIP
 | | Phage phi29 transcription regulator p4 | | Descriptor: | Late genes activator | | Authors: | Badia, D, Camacho, A, Perez-Lago, L, Escandon, C, Salas, M, Coll, M. | | Deposit date: | 2005-12-30 | | Release date: | 2006-09-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The structure of phage phi29 transcription regulator p4-DNA complex reveals an N-hook motif for DNA
Mol.Cell, 22, 2006
|
|
1X7T
 | | Structure of TTR R104H: a non-amyloidogenic variant with protective clinical effects | | Descriptor: | Transthyretin | | Authors: | Neto-Silva, R.M, Macedo-Ribeiro, S, Pereira, P.J.B, Coll, M, Saraiva, M.J, Damas, A.M. | | Deposit date: | 2004-08-16 | | Release date: | 2005-03-22 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | X-ray crystallographic studies of two transthyretin variants: further insights into amyloidogenesis.
Acta Crystallogr.,Sect.D, 61, 2005
|
|
1DZA
 | | 3-D structure of a HP-RNase | | Descriptor: | RIBONUCLEASE 1 | | Authors: | Pous, J, Canals, A, Terzyan, S.S, Guasch, A, Benito, A, Ribo, M, Vilanova, M, Coll, M. | | Deposit date: | 2000-02-21 | | Release date: | 2001-02-16 | | Last modified: | 2023-12-06 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Three-Dimensional Structure of a Human Pancreatic Ribonuclease Variant, a Step Forward in the Design of Cytotoxic Ribonucleases
J.Mol.Biol., 303, 2000
|
|
1GL6
 | | Plasmid coupling protein TrwB in complex with the non-hydrolysable GTP analogue GDPNP | | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ATPASE, CHLORIDE ION, ... | | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | | Deposit date: | 2001-08-28 | | Release date: | 2002-05-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase
Nature, 409, 2001
|
|
1GL7
 | | Plasmid coupling protein TrwB in complex with the non-hydrolisable ATP-analogue ADPNP. | | Descriptor: | CHLORIDE ION, CONJUGAL TRANSFER PROTEIN TRWB, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | | Deposit date: | 2001-08-28 | | Release date: | 2002-05-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase
Nature, 409, 2001
|
|
1GKI
 | | Plasmid coupling protein TrwB in complex with ADP and Mg2+. | | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ADENOSINE-5'-DIPHOSPHATE, CONJUGAL TRANSFER PROTEIN TRWB, ... | | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | | Deposit date: | 2001-08-14 | | Release date: | 2002-05-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase
Nature, 409, 2001
|
|
1H8X
 | | Domain-swapped Dimer of a Human Pancreatic Ribonuclease Variant | | Descriptor: | RIBONUCLEASE 1 | | Authors: | Canals, A, Pous, J, Guasch, A, Benito, A, Ribo, M, Vilanova, M, Coll, M. | | Deposit date: | 2001-02-16 | | Release date: | 2002-02-14 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The Structure of an Engineered Domain-Swapped Ribonuclease Dimer and its Implications for the Evolution of Proteins Toward Oligomerization
Structure, 9, 2001
|
|
1HEY
 | |
1H8L
 | | Duck Carboxypeptidase D Domain II in complex with GEMSA | | Descriptor: | (2-GUANIDINOETHYLMERCAPTO)SUCCINIC ACID, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Gomis-Rueth, F.X, Coll, M, Aviles, F.X, Vendrell, J, Fricker, L.D. | | Deposit date: | 2001-02-09 | | Release date: | 2002-02-08 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The crystal structure of the inhibitor-complexed carboxypeptidase D domain II and the modeling of regulatory carboxypeptidases.
J. Biol. Chem., 276, 2001
|
|
1GTI
 | | MODIFIED GLUTATHIONE S-TRANSFERASE (PI) COMPLEXED WITH S (P-NITROBENZYL)GLUTATHIONE | | Descriptor: | GLUTATHIONE S-TRANSFERASE, S-(P-NITROBENZYL)GLUTATHIONE | | Authors: | Vega, M.C, Coll, M. | | Deposit date: | 1998-01-09 | | Release date: | 1999-03-02 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The three-dimensional structure of Cys-47-modified mouse liver glutathione S-transferase P1-1. Carboxymethylation dramatically decreases the affinity for glutathione and is associated with a loss of electron density in the alphaB-310B region.
J.Biol.Chem., 273, 1998
|
|
