1GH6
 
 | | RETINOBLASTOMA POCKET COMPLEXED WITH SV40 LARGE T ANTIGEN | | Descriptor: | Large T antigen, Retinoblastoma-associated protein | | Authors: | Kim, H.Y, Cho, Y. | | Deposit date: | 2000-11-15 | | Release date: | 2001-11-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural basis for the inactivation of retinoblastoma tumor suppressor by SV40 large T antigen.
EMBO J., 20, 2001
|
|
4R3Z
 | | Crystal structure of human ArgRS-GlnRS-AIMP1 complex | | Descriptor: | Aminoacyl tRNA synthase complex-interacting multifunctional protein 1, Arginine--tRNA ligase, cytoplasmic, ... | | Authors: | Fu, Y, Kim, Y, Cho, Y. | | Deposit date: | 2014-08-18 | | Release date: | 2014-10-08 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (4.033 Å) | | Cite: | Structure of the ArgRS-GlnRS-AIMP1 complex and its implications for mammalian translation
Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
4P0P
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
8IEC
 | | Cryo-EM structure of miniGo-scFv16 of GPR156-miniGo-scFv16 complex (local refine) | | Descriptor: | Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-2, Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1, Guanine nucleotide-binding protein G(o) subunit alpha, ... | | Authors: | Shin, J, Park, J, Cho, Y. | | Deposit date: | 2023-02-15 | | Release date: | 2024-02-14 | | Last modified: | 2024-05-01 | | Method: | ELECTRON MICROSCOPY (3.18 Å) | | Cite: | Constitutive activation mechanism of a class C GPCR.
Nat.Struct.Mol.Biol., 31, 2024
|
|
8IEQ
 | | Cryo-EM structure of G-protein free GPR156 | | Descriptor: | Probable G-protein coupled receptor 156, [(2R)-3-[(E)-hexadec-9-enoyl]oxy-2-octadecanoyloxy-propyl] 2-(trimethylazaniumyl)ethyl phosphate | | Authors: | Shin, J, Park, J, Cho, Y. | | Deposit date: | 2023-02-15 | | Release date: | 2024-02-14 | | Last modified: | 2024-05-01 | | Method: | ELECTRON MICROSCOPY (2.73 Å) | | Cite: | Constitutive activation mechanism of a class C GPCR.
Nat.Struct.Mol.Biol., 31, 2024
|
|
8IEI
 | |
8IEB
 | |
8IEP
 | |
8IED
 | | Cryo-EM structure of GPR156-miniGo-scFv16 complex | | Descriptor: | Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-2, Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1, Guanine nucleotide-binding protein G(o) subunit alpha, ... | | Authors: | Shin, J, Park, J, Cho, Y. | | Deposit date: | 2023-02-15 | | Release date: | 2024-02-14 | | Last modified: | 2024-05-01 | | Method: | ELECTRON MICROSCOPY (3.33 Å) | | Cite: | Constitutive activation mechanism of a class C GPCR.
Nat.Struct.Mol.Biol., 31, 2024
|
|
3T1I
 | | Crystal Structure of Human Mre11: Understanding Tumorigenic Mutations | | Descriptor: | 2,3-DIHYDROXY-1,4-DITHIOBUTANE, Double-strand break repair protein MRE11A, GLYCEROL, ... | | Authors: | Park, Y.B, Chae, J, Kim, Y, Cho, Y. | | Deposit date: | 2011-07-22 | | Release date: | 2011-11-30 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of human mre11: understanding tumorigenic mutations
Structure, 19, 2011
|
|
3IJJ
 | | Ternary Complex of Macrophage Migration Inhibitory Factor (MIF) Bound Both to 4-hydroxyphenylpyruvate and to the Allosteric Inhibitor AV1013 (R-stereoisomer) | | Descriptor: | (2E)-2-hydroxy-3-(4-hydroxyphenyl)prop-2-enoic acid, (2R)-2-amino-1-[2-(1-methylethyl)pyrazolo[1,5-a]pyridin-3-yl]propan-1-one, 3-(4-HYDROXY-PHENYL)PYRUVIC ACID, ... | | Authors: | Crichlow, G.V, Cho, Y, Lolis, E.J. | | Deposit date: | 2009-08-04 | | Release date: | 2010-06-16 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.25 Å) | | Cite: | Allosteric inhibition of macrophage migration inhibitory factor revealed by ibudilast.
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
3IJG
 | | Macrophage Migration Inhibitory Factor (MIF) Bound to the (R)-Stereoisomer of AV1013 | | Descriptor: | (2R)-2-amino-1-[2-(1-methylethyl)pyrazolo[1,5-a]pyridin-3-yl]propan-1-one, CHLORIDE ION, Macrophage migration inhibitory factor | | Authors: | Crichlow, G.V, Cho, Y, Lolis, E.J. | | Deposit date: | 2009-08-04 | | Release date: | 2010-06-16 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Allosteric inhibition of macrophage migration inhibitory factor revealed by ibudilast.
Proc.Natl.Acad.Sci.USA, 107, 2010
|
|
1COJ
 | | FE-SOD FROM AQUIFEX PYROPHILUS, A HYPERTHERMOPHILIC BACTERIUM | | Descriptor: | FE (III) ION, PROTEIN (SUPEROXIDE DISMUTASE) | | Authors: | Lim, J.H, Yu, Y.G, Kim, S.-H, Cho, S.-J, Ahn, B.Y, Han, Y.S, Cho, Y. | | Deposit date: | 1999-05-28 | | Release date: | 1999-06-14 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | The crystal structure of an Fe-superoxide dismutase from the hyperthermophile Aquifex pyrophilus at 1.9 A resolution: structural basis for thermostability.
J.Mol.Biol., 270, 1997
|
|
1N6A
 | | Structure of SET7/9 | | Descriptor: | S-ADENOSYLMETHIONINE, SET domain-containing protein 7 | | Authors: | Kwon, T.W, Chang, J.H, Kwak, E, Lee, C.W, Joachimiak, A, Kim, Y.C, Lee, J, Cho, Y. | | Deposit date: | 2002-11-09 | | Release date: | 2003-02-04 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Mechanism of histone lysine methyl transfer revealed by the structure of SET7/9-AdoMet
EMBO J., 22, 2003
|
|
1N6C
 | | Structure of SET7/9 | | Descriptor: | S-ADENOSYLMETHIONINE, SET domain-containing protein 7 | | Authors: | Kwon, T.W, Chang, J.H, Cho, Y. | | Deposit date: | 2002-11-09 | | Release date: | 2003-02-04 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Mechanism of histone lysine methyl transfer revealed by the structure of SET7/9-AdoMet
EMBO J., 22, 2003
|
|
1B73
 | | GLUTAMATE RACEMASE FROM AQUIFEX PYROPHILUS | | Descriptor: | GLUTAMATE RACEMASE | | Authors: | Hwang, K.Y, Cho, C.S, Kim, S.S, Yu, Y.G, Cho, Y. | | Deposit date: | 1999-01-26 | | Release date: | 1999-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure and mechanism of glutamate racemase from Aquifex pyrophilus.
Nat.Struct.Biol., 6, 1999
|
|
1B74
 | | GLUTAMATE RACEMASE FROM AQUIFEX PYROPHILUS | | Descriptor: | D-GLUTAMINE, GLUTAMATE RACEMASE | | Authors: | Hwang, K.Y, Cho, C.S, Kim, S.S, Yu, Y.G, Cho, Y. | | Deposit date: | 1999-01-27 | | Release date: | 2000-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure and mechanism of glutamate racemase from Aquifex pyrophilus.
Nat.Struct.Biol., 6, 1999
|
|
1R6L
 | | Crystal Structure Of The tRNA Processing Enzyme Rnase pH From Pseudomonas Aeruginosa | | Descriptor: | 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, Ribonuclease PH, SULFATE ION | | Authors: | Choi, J.M, Park, E.Y, Kim, J.H, Chang, S.K, Cho, Y. | | Deposit date: | 2003-10-15 | | Release date: | 2004-02-17 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Probing the functional importance of the hexameric ring structure of RNase PH
J.BIOL.CHEM., 279, 2004
|
|
7WRS
 | |
7WRU
 | |
3TAL
 | | Crystal structure of NurA with manganese | | Descriptor: | DNA double-strand break repair protein nurA, GLYCEROL, MANGANESE (II) ION | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2013-07-03 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
3TAZ
 | | Crystal structure of NurA bound to dAMP and manganese | | Descriptor: | 2'-DEOXYADENOSINE-5'-MONOPHOSPHATE, DNA double-strand break repair protein nurA, GLYCEROL, ... | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
