1KQC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kqc by Molmil](/molmil-images/mine/1kqc) | Structure of Nitroreductase from E. cloacae Complex with Inhibitor Acetate | Descriptor: | ACETATE ION, FLAVIN MONONUCLEOTIDE, OXYGEN-INSENSITIVE NAD(P)H NITROREDUCTASE | Authors: | Haynes, C.A, Koder, R.L, Miller, A.F, Rodgers, D.W. | Deposit date: | 2002-01-04 | Release date: | 2002-02-13 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structures of nitroreductase in three states: effects of inhibitor binding and reduction. J.Biol.Chem., 277, 2002
|
|
1KU2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ku2 by Molmil](/molmil-images/mine/1ku2) | Crystal Structure of Thermus aquaticus RNA Polymerase Sigma Subunit Fragment Containing Regions 1.2 to 3.1 | Descriptor: | SULFATE ION, sigma factor sigA | Authors: | Campbell, E.A, Muzzin, O, Chlenov, M, Sun, J.L, Olson, C.A, Weinman, O, Trester-Zedlitz, M.L, Darst, S.A. | Deposit date: | 2002-01-21 | Release date: | 2002-04-03 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structure of the bacterial RNA polymerase promoter specificity sigma subunit. Mol.Cell, 9, 2002
|
|
1KRW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1krw by Molmil](/molmil-images/mine/1krw) | SOLUTION STRUCTURE AND BACKBONE DYNAMICS OF BERYLLOFLUORIDE-ACTIVATED NTRC RECEIVER DOMAIN | Descriptor: | NITROGEN REGULATION PROTEIN NR(I) | Authors: | Hastings, C.A, Lee, S.-Y, Cho, H.S, Yan, D, Kustu, S, Wemmer, D.E. | Deposit date: | 2002-01-10 | Release date: | 2003-08-19 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | High-Resolution Solution Structure of the Beryllofluoride-Activated NtrC Receiver Domain Biochemistry, 42, 2003
|
|
1KJ4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kj4 by Molmil](/molmil-images/mine/1kj4) | |
1KJH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kjh by Molmil](/molmil-images/mine/1kjh) | |
1KMS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kms by Molmil](/molmil-images/mine/1kms) | HUMAN DIHYDROFOLATE REDUCTASE COMPLEXED WITH NADPH AND 6-([5-QUINOLYLAMINO]METHYL)-2,4-DIAMINO-5-METHYLPYRIDO[2,3-D]PYRIMIDINE (SRI-9439), A LIPOPHILIC ANTIFOLATE | Descriptor: | 6-([5-QUINOLYLAMINO]METHYL)-2,4-DIAMINO-5-METHYLPYRIDO[2,3-D]PYRIMIDINE, DIHYDROFOLATE REDUCTASE, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, ... | Authors: | Klon, A.E, Heroux, A, Ross, L.J, Pathak, V, Johnson, C.A, Piper, J.R, Borhani, D.W. | Deposit date: | 2001-12-17 | Release date: | 2002-07-10 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.09 Å) | Cite: | Atomic structures of human dihydrofolate reductase complexed with NADPH and two lipophilic antifolates at 1.09 a and 1.05 a resolution. J.Mol.Biol., 320, 2002
|
|
4H99
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4h99 by Molmil](/molmil-images/mine/4h99) | |
4HBH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4hbh by Molmil](/molmil-images/mine/4hbh) | |
1KKH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kkh by Molmil](/molmil-images/mine/1kkh) | Crystal Structure of the Methanococcus jannaschii Mevalonate Kinase | Descriptor: | 1,4-DIETHYLENE DIOXIDE, Mevalonate Kinase | Authors: | Yang, D, Shipman, L.W, Roessner, C.A, Scott, A.I, Sacchettini, J.C. | Deposit date: | 2001-12-08 | Release date: | 2002-03-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of the Methanococcus jannaschii mevalonate kinase, a member of the GHMP kinase superfamily. J.Biol.Chem., 277, 2002
|
|
1KSP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ksp by Molmil](/molmil-images/mine/1ksp) | DNA polymerase I Klenow fragment (E.C.2.7.7.7) mutant/DNA complex | Descriptor: | DNA (5'-D(P*TP*TP*PST)-3'), PROTEIN (DNA POLYMERASE I-KLENOW FRAGMENT (E.C.2.7.7.7)), ZINC ION | Authors: | Brautigam, C.A, Steitz, T.A. | Deposit date: | 1997-08-19 | Release date: | 1998-02-25 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structural principles for the inhibition of the 3'-5' exonuclease activity of Escherichia coli DNA polymerase I by phosphorothioates. J.Mol.Biol., 277, 1998
|
|
1KR3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kr3 by Molmil](/molmil-images/mine/1kr3) | Crystal Structure of the Metallo beta-Lactamase from Bacteroides fragilis (CfiA) in Complex with the Tricyclic Inhibitor SB-236050. | Descriptor: | 7,8-DIHYDROXY-1-METHOXY-3-METHYL-10-OXO-4,10-DIHYDRO-1H,3H-PYRANO[4,3-B]CHROMENE-9-CARBOXYLIC ACID, SODIUM ION, ZINC ION, ... | Authors: | Payne, D.J, Hueso-Rodrguez, J.A, Boyd, H, Concha, N.O, Janson, C.A, Gilpin, M, Bateson, J.H, Cheever, C, Niconovich, N.L, Pearson, S, Rittenhouse, S, Tew, D, Dez, E, Prez, P, de la Fuente, J, Rees, M, Rivera-Sagredo, A. | Deposit date: | 2002-01-08 | Release date: | 2003-01-08 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Identification of a series of tricyclic natural products as potent broad-spectrum inhibitors of metallo-beta-lactamases ANTIMICROB.AGENTS CHEMOTHER., 46, 2002
|
|
1KRP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1krp by Molmil](/molmil-images/mine/1krp) | DNA polymerase I Klenow fragment (E.C.2.7.7.7) mutant/DNA complex | Descriptor: | DNA (5'-D(P*TP*TP*PST)-3'), PROTEIN (DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7)), ZINC ION | Authors: | Brautigam, C.A, Steitz, T.A. | Deposit date: | 1997-08-19 | Release date: | 1998-02-25 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structural principles for the inhibition of the 3'-5' exonuclease activity of Escherichia coli DNA polymerase I by phosphorothioates. J.Mol.Biol., 277, 1998
|
|
2FZ8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2fz8 by Molmil](/molmil-images/mine/2fz8) | Human Aldose reductase complexed with inhibitor zopolrestat at 1.48 A(1 day soaking). | Descriptor: | 3,4-DIHYDRO-4-OXO-3-((5-TRIFLUOROMETHYL-2-BENZOTHIAZOLYL)METHYL)-1-PHTHALAZINE ACETIC ACID, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, aldose reductase | Authors: | Steuber, H, Zentgraf, M, Gerlach, C, Sotriffer, C.A, Heine, A, Klebe, G. | Deposit date: | 2006-02-09 | Release date: | 2006-10-03 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.48 Å) | Cite: | Expect the Unexpected or Caveat for Drug Designers: Multiple Structure Determinations Using Aldose Reductase Crystals Treated under Varying Soaking and Co-crystallisation Conditions. J.Mol.Biol., 363, 2006
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
2G0A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2g0a by Molmil](/molmil-images/mine/2g0a) | X-ray structure of mouse pyrimidine 5'-nucleotidase type 1 with lead(II) bound in active site | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, Cytosolic 5'-nucleotidase III, LEAD (II) ION | Authors: | Bitto, E, Bingman, C.A, Wesenberg, G.E, Phillips Jr, G.N, Center for Eukaryotic Structural Genomics (CESG) | Deposit date: | 2006-02-11 | Release date: | 2006-04-04 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Structure of pyrimidine 5'-nucleotidase type 1. Insight into mechanism of action and inhibition during lead poisoning. J.Biol.Chem., 281, 2006
|
|
2FQW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2fqw by Molmil](/molmil-images/mine/2fqw) | PnrA from Treponema pallidum as purified from E. coli (bound to inosine) | Descriptor: | INOSINE, Membrane lipoprotein tmpC | Authors: | Brautigam, C.A, Deka, R.K, Tomchick, D.R, Machius, M, Norgard, M.V. | Deposit date: | 2006-01-18 | Release date: | 2006-02-14 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.71 Å) | Cite: | The PnrA (Tp0319; TmpC) lipoprotein represents a new family of bacterial purine nucleoside receptor encoded within an ATP-binding cassette (ABC)-like operon in Treponema pallidum J.Biol.Chem., 281, 2006
|
|
1KU7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ku7 by Molmil](/molmil-images/mine/1ku7) | Crystal Structure of Thermus aquatics RNA Polymerase SigmaA Subunit Region 4 Bound to-35 Element DNA | Descriptor: | 5'-D(*CP*CP*TP*TP*GP*AP*CP*AP*AP*AP*G)-3', 5'-D(*CP*CP*TP*TP*TP*GP*TP*CP*AP*AP*G)-3', sigma factor sigA | Authors: | Campbell, E.A, Muzzin, O, Chlenov, M, Sun, J.L, Olson, C.A, Weinman, O, Trester-Zedlitz, M.L, Darst, S.A. | Deposit date: | 2002-01-21 | Release date: | 2002-03-29 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structure of the bacterial RNA polymerase promoter specificity sigma subunit. Mol.Cell, 9, 2002
|
|
4LRF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4lrf by Molmil](/molmil-images/mine/4lrf) | Phosphopentomutase S154G variant soaked with ribose 5-phosphate | Descriptor: | 5-O-phosphono-alpha-D-ribofuranose, GLYCEROL, MANGANESE (II) ION, ... | Authors: | Birmingham, W.A, Starbird, C.A, Panosian, T.D, Nannemann, D.P, Iverson, T.M, Bachmann, B.O. | Deposit date: | 2013-07-19 | Release date: | 2013-07-31 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Bioretrosynthetic construction of a didanosine biosynthetic pathway. Nat.Chem.Biol., 10, 2014
|
|
1KU3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ku3 by Molmil](/molmil-images/mine/1ku3) | Crystal Structure of Thermus aquaticus RNA Polymerase Sigma Subunit Fragment, Region 4 | Descriptor: | sigma factor sigA | Authors: | Campbell, E.A, Muzzin, O, Chlenov, M, Sun, J.L, Olson, C.A, Weinman, O, Trester-Zedlitz, M.L, Darst, S.A. | Deposit date: | 2002-01-21 | Release date: | 2002-04-03 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structure of the bacterial RNA polymerase promoter specificity sigma subunit. Mol.Cell, 9, 2002
|
|
2FZB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2fzb by Molmil](/molmil-images/mine/2fzb) | Human Aldose Reductase complexed with four tolrestat molecules at 1.5 A resolution. | Descriptor: | NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, TOLRESTAT, aldose reductase | Authors: | Steuber, H, Zentgraf, M, Gerlach, C, Sotriffer, C.A, Heine, A, Klebe, G. | Deposit date: | 2006-02-09 | Release date: | 2006-10-03 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Expect the Unexpected or Caveat for Drug Designers: Multiple Structure Determinations Using Aldose Reductase Crystals Treated under Varying Soaking and Co-crystallisation Conditions. J.Mol.Biol., 363, 2006
|
|
2G5W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2g5w by Molmil](/molmil-images/mine/2g5w) | X-ray crystal structure of Arabidopsis thaliana 12-oxophytodienoate reductase isoform 3 (AtOPR3) in complex with 8-iso prostaglandin A1 and its cofactor, flavin mononucleotide. | Descriptor: | (8S,12S)-15S-HYDROXY-9-OXOPROSTA-10Z,13E-DIEN-1-OIC ACID, 12-oxophytodienoate reductase 3, FLAVIN MONONUCLEOTIDE | Authors: | Han, B.W, Malone, T.E, Bingman, C.A, Wesenberg, G.E, Phillips Jr, G.N, Fox, B.G, Center for Eukaryotic Structural Genomics (CESG) | Deposit date: | 2006-02-23 | Release date: | 2006-04-04 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.576 Å) | Cite: | Crystal structure of Arabidopsis thaliana 12-oxophytodienoate reductase isoform 3 in complex with 8-iso prostaglandin A(1). Proteins, 79, 2011
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
2FQY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2fqy by Molmil](/molmil-images/mine/2fqy) | PnrA from Treponema pallidum complexed with adenosine. | Descriptor: | ADENOSINE, Membrane lipoprotein tmpC | Authors: | Brautigam, C.A, Deka, R.K, Tomchick, D.R, Machius, M, Norgard, M.V. | Deposit date: | 2006-01-18 | Release date: | 2006-02-14 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | The PnrA (Tp0319; TmpC) lipoprotein represents a new family of bacterial purine nucleoside receptor encoded within an ATP-binding cassette (ABC)-like operon in Treponema pallidum J.Biol.Chem., 281, 2006
|
|
4I19
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4i19 by Molmil](/molmil-images/mine/4i19) | The crystal structure of an epoxide hydrolase from Streptomyces carzinostaticus subsp. neocarzinostaticus. | Descriptor: | ACETATE ION, Epoxide hydrolase, FORMIC ACID | Authors: | Tan, K, Bigelow, L, Clancy, S, Babnigg, G, Bingman, C.A, Yennamalli, R, Lohman, J, Ma, M, Shen, B, Phillips Jr, G.N, Joachimiak, A, Midwest Center for Structural Genomics (MCSG), Enzyme Discovery for Natural Product Biosynthesis (NatPro) | Deposit date: | 2012-11-20 | Release date: | 2012-12-05 | Last modified: | 2013-01-30 | Method: | X-RAY DIFFRACTION (2.148 Å) | Cite: | The crystal structure of an epoxide hydrolase from Streptomyces carzinostaticus subsp. neocarzinostaticus. To be Published
|
|
4ND8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4nd8 by Molmil](/molmil-images/mine/4nd8) | Av Nitrogenase MoFe Protein High pH Form | Descriptor: | 3-HYDROXY-3-CARBOXY-ADIPIC ACID, FE (III) ION, FE(8)-S(7) CLUSTER, ... | Authors: | Yang, K.-Y, Haynes, C.A, Spatzal, T, Rees, D.C, Howard, J.B. | Deposit date: | 2013-10-25 | Release date: | 2014-01-15 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Turnover-Dependent Inactivation of the Nitrogenase MoFe-Protein at High pH. Biochemistry, 53, 2014
|
|