1IE1
 
 | | NMR Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by Hamster Nucleolin RBD12. | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1IE2
 | | Solution Structure of an In Vitro Selected RNA which is Sequence Specifically Recognized by RBD12 of Hamster Nucleolin.sNRE (anti) | | Descriptor: | 5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*UP*CP*CP*CP*GP*AP*AP*GP*UP*AP*GP*GP*CP*C)-3' | | Authors: | Bouvet, P, Allain, F.H.-T, Finger, L.D, Dieckmann, T, Feigon, J. | | Deposit date: | 2001-04-05 | | Release date: | 2001-06-20 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Recognition of pre-formed and flexible elements of an RNA stem-loop by nucleolin.
J.Mol.Biol., 309, 2001
|
|
1F4I
 | | SOLUTION STRUCTURE OF THE HHR23A UBA(2) MUTANT P333E, DEFICIENT IN BINDING THE HIV-1 ACCESSORY PROTEIN VPR | | Descriptor: | UV EXCISION REPAIR PROTEIN PROTEIN RAD23 HOMOLOG A | | Authors: | Withers-Ward, E.S, Mueller, T.D, Chen, I.S, Feigon, J. | | Deposit date: | 2000-06-07 | | Release date: | 2000-12-20 | | Last modified: | 2021-11-03 | | Method: | SOLUTION NMR | | Cite: | Biochemical and structural analysis of the interaction between the UBA(2) domain of the DNA repair protein HHR23A and HIV-1 Vpr.
Biochemistry, 39, 2000
|
|
1DV0
 | |
1K4B
 | | STRUCTURE OF AGUU RNA TETRALOOP, NMR, 20 STRUCTURES | | Descriptor: | 5'-R(*GP*GP*UP*UP*CP*AP*GP*UP*UP*GP*AP*AP*CP*C)-3' | | Authors: | Wu, H, Yang, P.K, Butcher, S.E, Kang, S, Chanfreau, G, Feigon, J. | | Deposit date: | 2001-10-07 | | Release date: | 2001-12-19 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III.
EMBO J., 20, 2001
|
|
1K4A
 | | STRUCTURE OF AGAA RNA TETRALOOP, NMR, 20 STRUCTURES | | Descriptor: | 5'-R(*GP*GP*UP*UP*CP*AP*GP*AP*AP*GP*AP*AP*CP*C)-3' | | Authors: | Wu, H, Yang, P.K, Butcher, S.E, Kang, S, Chanfreau, G, Feigon, J. | | Deposit date: | 2001-10-07 | | Release date: | 2001-12-19 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III.
EMBO J., 20, 2001
|
|
1P9C
 | |
1P9D
 | |
2LBS
 | | Solution structure of double-stranded RNA binding domain of S. cerevisiae RNase III (Rnt1p) in complex with AAGU tetraloop hairpin | | Descriptor: | RNA (32-MER), Ribonuclease 3 | | Authors: | Wang, Z, Hartman, E, Roy, K, Chanfreau, G, Feigon, J. | | Deposit date: | 2011-04-06 | | Release date: | 2011-08-31 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structure of a Yeast RNase III dsRBD Complex with a Noncanonical RNA Substrate Provides New Insights into Binding Specificity of dsRBDs.
Structure, 19, 2011
|
|
2LUP
 | |
2LUQ
 | |
1LWA
 | | Solution Structure of SRY_DNA | | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3' | | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | | Deposit date: | 2002-05-30 | | Release date: | 2002-10-16 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding
J.Mol.Biol., 323, 2002
|
|
1J5N
 | | Solution Structure of the Non-Sequence-Specific HMGB protein NHP6A in complex with SRY DNA | | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3', Nonhistone chromosomal protein 6A | | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | | Deposit date: | 2002-05-15 | | Release date: | 2002-10-16 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding
J.Mol.Biol., 323, 2002
|
|
1TLR
 | |
1QWA
 | | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | | Descriptor: | 18S ribosomal RNA, 5'ETS | | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | | Deposit date: | 2003-09-01 | | Release date: | 2003-11-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin
Nucleic Acids Res., 31, 2003
|
|
1QWB
 | |
1P3X
 | | INTRAMOLECULAR DNA TRIPLEX WITH 1-PROPYNYL DEOXYURIDINE IN THE THIRD STRAND, NMR, 10 STRUCTURES | | Descriptor: | DNA (5'-D(*(PDU)P*CP*(PDU)P*(DCM)P*(PDU)P*CP*(PDU)P*(PDU))-3'), DNA (5'-D(*AP*GP*AP*GP*AP*GP*AP*A)-3'), DNA (5'-D(*TP*TP*CP*TP*CP*TP*CP*T)-3') | | Authors: | Phipps, A.K, Tarkoy, M, Schultze, P, Feigon, J. | | Deposit date: | 1998-02-05 | | Release date: | 1998-05-06 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution structure of an intramolecular DNA triplex containing 5-(1-propynyl)-2'-deoxyuridine residues in the third strand.
Biochemistry, 37, 1998
|
|
1RVH
 | | SOLUTION STRUCTURE OF THE DNA DODECAMER GCAAAATTTTGC | | Descriptor: | 5'-D(*GP*CP*AP*AP*AP*AP*TP*TP*TP*TP*GP*C)-3' | | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | | Deposit date: | 2003-12-13 | | Release date: | 2004-02-10 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum.
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1RVI
 | | SOLUTION STRUCTURE OF THE DNA DODECAMER CGTTTTAAAACG | | Descriptor: | 5'-D(*CP*GP*TP*TP*TP*TP*AP*AP*AP*AP*CP*G)-3' | | Authors: | Stefl, R, Wu, H, Ravindranathan, S, Sklenar, V, Feigon, J. | | Deposit date: | 2003-12-13 | | Release date: | 2004-02-10 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | DNA A-tract bending in three dimensions: Solving the dA4T4 vs. dT4A4 conundrum.
Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
1NA2
 | |
1PG1
 | | PROTEGRIN 1 (PG1) FROM PORCINE LEUKOCYTES, NMR, 20 STRUCTURES | | Descriptor: | PROTEGRIN-1 | | Authors: | Fahrner, R.L, Dieckmann, T, Harwig, S.S.L, Lehrer, R.I, Eisenberg, D, Feigon, J. | | Deposit date: | 1998-03-20 | | Release date: | 1998-05-27 | | Last modified: | 2022-02-23 | | Method: | SOLUTION NMR | | Cite: | Solution structure of protegrin-1, a broad-spectrum antimicrobial peptide from porcine leukocytes.
Chem.Biol., 3, 1996
|
|
1CG7
 | | HMG PROTEIN NHP6A FROM SACCHAROMYCES CEREVISIAE | | Descriptor: | PROTEIN (NON HISTONE PROTEIN 6 A) | | Authors: | Allain, F.H.T, Yen, Y.M, Masse, J.E, Schultze, P, Dieckmann, T, Johnson, R.C, Feigon, J. | | Deposit date: | 1999-03-27 | | Release date: | 1999-10-14 | | Last modified: | 2023-12-27 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the HMG protein NHP6A and its interaction with DNA reveals the structural determinants for non-sequence-specific binding.
EMBO J., 18, 1999
|
|
1GN7
 | |
1RAW
 | |
1RKJ
 | | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target | | Descriptor: | 5'-R(*GP*GP*AP*UP*GP*CP*CP*UP*CP*CP*CP*GP*AP*GP*UP*GP*CP*AP*UP*CP*C)-3', Nucleolin | | Authors: | Johansson, C, Finger, L.D, Trantirek, L, Mueller, T.D, Kim, S, Laird-Offringa, I.A, Feigon, J. | | Deposit date: | 2003-11-21 | | Release date: | 2004-04-27 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the complex formed by the two N-terminal RNA-binding domains of nucleolin and a pre-rRNA target.
J.Mol.Biol., 337, 2004
|
|
