1TLR
SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES
Summary for 1TLR
| Entry DOI | 10.2210/pdb1tlr/pdb |
| Descriptor | RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3') (1 entity in total) |
| Functional Keywords | ribonucleic acid, tetraloop receptor, group i intron, group ii intron, rna |
| Total number of polymer chains | 1 |
| Total formula weight | 7356.39 |
| Authors | Butcher, S.E.,Dieckmann, T.,Feigon, J. (deposition date: 1997-09-11, release date: 1997-11-12, Last modification date: 2024-05-22) |
| Primary citation | Butcher, S.E.,Dieckmann, T.,Feigon, J. Solution structure of a GAAA tetraloop receptor RNA. EMBO J., 16:7490-7499, 1997 Cited by PubMed Abstract: The GAAA tetraloop receptor is an 11-nucleotide RNA sequence that participates in the tertiary folding of a variety of large catalytic RNAs by providing a specific binding site for GAAA tetraloops. Here we report the solution structure of the isolated tetraloop receptor as solved by multidimensional, heteronuclear magnetic resonance spectroscopy. The internal loop of the tetraloop receptor has three adenosines stacked in a cross-strand or zipper-like fashion. This arrangement produces a high degree of base stacking within the asymmetric internal loop without extrahelical bases or kinking the helix. Additional interactions within the internal loop include a U. U mismatch pair and a G.U wobble pair. A comparison with the crystal structure of the receptor RNA bound to its tetraloop shows that a conformational change has to occur upon tetraloop binding, which is in good agreement with previous biochemical data. A model for an alternative binding site within the receptor is proposed based on the NMR structure, phylogenetic data and previous crystallographic structures of tetraloop interactions. PubMed: 9405377DOI: 10.1093/emboj/16.24.7490 PDB entries with the same primary citation |
| Experimental method | SOLUTION NMR |
Structure validation
Download full validation report






