2NTG
 
 | | Structure of Spin-labeled T4 Lysozyme Mutant T115R7 | | Descriptor: | BETA-MERCAPTOETHANOL, Lysozyme, S-[(4-bromo-1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2006-11-07 | | Release date: | 2007-06-12 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2022-03-23 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
2OU8
 | | Structure of Spin-labeled T4 Lysozyme Mutant T115R1 at Room Temperature | | Descriptor: | BETA-MERCAPTOETHANOL, Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2007-02-09 | | Release date: | 2007-06-12 | | Last modified: | 2023-08-30 | | Method: | EPR (1.8 Å), X-RAY DIFFRACTION | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
2OU9
 | | Structure of Spin-labeled T4 Lysozyme Mutant T115R1/R119A | | Descriptor: | Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2007-02-09 | | Release date: | 2007-06-12 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.55 Å) | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
5FOY
 | | De novo structure of the binary mosquito larvicide BinAB at pH 7 | | Descriptor: | 41.9 KDA INSECTICIDAL TOXIN, LARVICIDAL TOXIN 51 KDA PROTEIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2019-08-28 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
5FOZ
 | | De novo structure of the binary mosquito larvicide BinAB at pH 10 | | Descriptor: | LARVICIDAL TOXIN PROTEIN, SODIUM ION, TOXIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
2Q9D
 | | Structure of spin-labeled T4 lysozyme mutant A41R1 | | Descriptor: | BETA-MERCAPTOETHANOL, Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2007-06-12 | | Release date: | 2007-06-26 | | Last modified: | 2023-08-30 | | Method: | EPR (1.4 Å), X-RAY DIFFRACTION | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Solvent-exposed sites in helix B of T4 lysozyme.
Protein Sci., 17, 2008
|
|
2Q9E
 | | Structure of spin-labeled T4 lysozyme mutant S44R1 | | Descriptor: | 2-HYDROXYETHYL DISULFIDE, Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2007-06-12 | | Release date: | 2007-06-26 | | Last modified: | 2023-08-30 | | Method: | EPR (2.1 Å), X-RAY DIFFRACTION | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Solvent-exposed sites in helix B of T4 lysozyme.
Protein Sci., 17, 2008
|
|
5G37
 | | MR structure of the binary mosquito larvicide BinAB at pH 5 | | Descriptor: | 41.9 KDA INSECTICIDAL TOXIN, LARVICIDAL TOXIN 51 KDA PROTEIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2016-04-24 | | Release date: | 2016-10-05 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
2QVK
 | |
2QVM
 | | The second Ca2+-binding domain of the Na+-Ca2+ exchanger is essential for regulation: crystal structures and mutational analysis | | Descriptor: | CALCIUM ION, Sodium/calcium exchanger 1 | | Authors: | Chaptal, V, Mercado Besserer, G, Abramson, J, Cascio, D. | | Deposit date: | 2007-08-08 | | Release date: | 2007-11-13 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.703 Å) | | Cite: | The second Ca2+-binding domain of the Na+ Ca2+ exchanger is essential for regulation: crystal structures and mutational analysis
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
2RIF
 | | CBS domain protein PAE2072 from Pyrobaculum aerophilum complexed with AMP | | Descriptor: | ADENOSINE MONOPHOSPHATE, CESIUM ION, Conserved protein with 2 CBS domains | | Authors: | Lee, T.M, King, N.P, Sawaya, M.R, Cascio, D, Yeates, T.O. | | Deposit date: | 2007-10-10 | | Release date: | 2008-06-17 | | Last modified: | 2017-10-25 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Structures and Functional Implications of an AMP-Binding Cystathionine beta-Synthase Domain Protein from a Hyperthermophilic Archaeon.
J.Mol.Biol., 380, 2008
|
|
1SLH
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and dUDP | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-DIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-05 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SNF
 | | MYCOBACTERIUM TUBERCULOSIS DUTPASE COMPLEXED WITH MAGNESIUM AND DEOXYURIDINE 5'-MONOPHOSPHATE | | Descriptor: | 2'-DEOXYURIDINE 5'-MONOPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-10 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
2RIH
 | | CBS domain protein PAE2072 from Pyrobaculum aerophilum | | Descriptor: | ACETIC ACID, Conserved protein with 2 CBS domains, SULFATE ION | | Authors: | Lee, T.M, King, N.P, Sawaya, M.R, Cascio, D, Yeates, T.O. | | Deposit date: | 2007-10-10 | | Release date: | 2008-06-17 | | Last modified: | 2017-10-25 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structures and Functional Implications of an AMP-Binding Cystathionine beta-Synthase Domain Protein from a Hyperthermophilic Archaeon
J.Mol.Biol., 380, 2008
|
|
1SIX
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and alpha,beta-imido-dUTP | | Descriptor: | 2'-DEOXYURIDINE 5'-ALPHA,BETA-IMIDO-TRIPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.-S, Kim, M, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-01 | | Release date: | 2004-03-09 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SM8
 | | M. tuberculosis dUTPase complexed with chromium and dUTP | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, CHROMIUM ION, DEOXYURIDINE-5'-TRIPHOSPHATE, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-08 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SJN
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and alpha,beta-imido-dUTP | | Descriptor: | 2'-DEOXYURIDINE 5'-ALPHA,BETA-IMIDO-TRIPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-04 | | Release date: | 2004-03-09 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SMC
 | | Mycobacterium tuberculosis dUTPase complexed with dUTP in the absence of metal ion. | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-TRIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-09 | | Release date: | 2004-03-16 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
4RF2
 | |
4RF4
 | |
4RKP
 | | Crystal Structure of Mevalonate-3-Kinase from Thermoplasma acidophilum (apo form) | | Descriptor: | ACETATE ION, Putative uncharacterized protein Ta1305, SULFATE ION | | Authors: | Vinokur, J.M, Cascio, D, Sawaya, M.R, Bowie, J.U. | | Deposit date: | 2014-10-13 | | Release date: | 2014-12-10 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structural analysis of mevalonate-3-kinase provides insight into the mechanisms of isoprenoid pathway decarboxylases.
Protein Sci., 24, 2015
|
|
4RKZ
 | | Crystal Structure of Mevalonate-3-Kinase from Thermoplasma acidophilum (Mevalonate 3-Phosphate/ADP Bound) | | Descriptor: | (3R)-5-hydroxy-3-methyl-3-(phosphonooxy)pentanoic acid, ADENOSINE-5'-DIPHOSPHATE, Putative uncharacterized protein Ta1305, ... | | Authors: | Vinokur, J.M, Cascio, D, Sawaya, M.R, Bowie, J.U. | | Deposit date: | 2014-10-14 | | Release date: | 2014-12-10 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structural analysis of mevalonate-3-kinase provides insight into the mechanisms of isoprenoid pathway decarboxylases.
Protein Sci., 24, 2015
|
|
4RKS
 | | Crystal Structure of Mevalonate-3-Kinase from Thermoplasma acidophilum (Mevalonate Bound) | | Descriptor: | (R)-MEVALONATE, ACETATE ION, GLYCEROL, ... | | Authors: | Vinokur, J.M, Cascio, D, Sawaya, M.R, Bowie, J.U. | | Deposit date: | 2014-10-13 | | Release date: | 2014-12-10 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structural analysis of mevalonate-3-kinase provides insight into the mechanisms of isoprenoid pathway decarboxylases.
Protein Sci., 24, 2015
|
|
4RQN
 | | Crystal structure of the native BICC1 SAM Domain R924E mutant | | Descriptor: | Protein bicaudal C homolog 1, ZINC ION | | Authors: | Leettola, C.N, Cascio, D, Bowie, J.U. | | Deposit date: | 2014-11-03 | | Release date: | 2016-01-27 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of Bicc1 SAM Polymer and Mapping of Interactions between the Ciliopathy-Associated Proteins Bicc1, ANKS3, and ANKS6.
Structure, 26, 2018
|
|
