2ZD7
| |
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1P34
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3L
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3G
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3I
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3P
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3M
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3O
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.75 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3B
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
2AYU
| |
1P3A
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3K
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3F
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
2F8N
| |
2FJ7
| Crystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence Element | Descriptor: | 147 bp DNA containing 16 bp poly dA element, 147 bp DNA containing 16 bp poly dT element, Histone H2B, ... | Authors: | Bao, Y, White, C.L, Luger, K. | Deposit date: | 2005-12-31 | Release date: | 2006-09-26 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Nucleosome Core Particles Containing a Poly(dA.dT) Sequence Element Exhibit a Locally Distorted DNA Structure. J.Mol.Biol., 361, 2006
|
|
1DLG
| CRYSTAL STRUCTURE OF THE C115S ENTEROBACTER CLOACAE MURA IN THE UN-LIGANDED STATE | Descriptor: | CYCLOHEXYLAMMONIUM ION, PHOSPHATE ION, UDP-N-ACETYLGLUCOSAMINE ENOLPYRUVYL TRANSFERASE MURA | Authors: | Schonbrunn, E, Eschenburg, S, Krekel, F, Luger, K, Amrhein, N. | Deposit date: | 1999-12-09 | Release date: | 2000-04-12 | Last modified: | 2021-11-03 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Role of the loop containing residue 115 in the induced-fit mechanism of the bacterial cell wall biosynthetic enzyme MurA. Biochemistry, 39, 2000
|
|
2Z2R
| Nucleosome assembly proteins I (NAP-1, 74-365) | Descriptor: | Nucleosome assembly protein | Authors: | Park, Y.J, Luger, K. | Deposit date: | 2007-05-25 | Release date: | 2008-03-11 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | A beta-hairpin comprising the nuclear localization sequence sustains the self-associated states of nucleosome assembly protein 1 J.Mol.Biol., 375, 2008
|
|
1ID3
| CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS | Descriptor: | HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ... | Authors: | White, C.L, Suto, R.K, Luger, K. | Deposit date: | 2001-04-03 | Release date: | 2001-09-28 | Last modified: | 2023-08-09 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions. EMBO J., 20, 2001
|
|
1M19
| LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
|
|
1M18
| LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
|
|
1M1A
| LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.MOL.BIOL., 326, 2003
|
|
4FO0
| Human actin-related protein Arp8 in its ATP-bound state | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Actin-related protein 8, CHLORIDE ION, ... | Authors: | Gerhold, C.B, Lakomek, K, Seifert, F.U, Hopfner, K.-P. | Deposit date: | 2012-06-20 | Release date: | 2012-09-26 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structure of Actin-related protein 8 and its contribution to nucleosome binding. Nucleic Acids Res., 40, 2012
|
|