1AOI
 
 | | COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT | | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | | Authors: | Luger, K, Maeder, A.W, Richmond, R.K, Sargent, D.F, Richmond, T.J. | | Deposit date: | 1997-07-03 | | Release date: | 1998-09-30 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of the nucleosome core particle at 2.8 A resolution.
Nature, 389, 1997
|
|
2NQB
 | | Drosophila Nucleosome Structure | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Luger, K, Chakravarthy, S. | | Deposit date: | 2006-10-30 | | Release date: | 2007-09-11 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Comparative analysis of nucleosome structures from different species.
To be Published
|
|
2AYU
 | |
7N8N
 | | Melbournevirus nucleosome like particle | | Descriptor: | DNA (147-MER), Histone H2B-H2A doublet, Histone H4-H3 doublet | | Authors: | Liu, Y, Toner, C.M, Zhou, K, Bowerman, S, Luger, K. | | Deposit date: | 2021-06-15 | | Release date: | 2021-08-04 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (3.89 Å) | | Cite: | Virus-encoded histone doublets are essential and form nucleosome-like structures.
Cell, 184, 2021
|
|
6C0W
 | | Cryo-EM structure of human kinetochore protein CENP-N with the centromeric nucleosome containing CENP-A | | Descriptor: | 147 mer DNA, Centromere protein N, Histone H2A, ... | | Authors: | Zhou, K, Pentakota, S, Vetter, I.R, Morgan, G.P, Petrovic, A, Musacchio, A, Luger, K. | | Deposit date: | 2018-01-02 | | Release date: | 2018-01-17 | | Last modified: | 2024-03-13 | | Method: | ELECTRON MICROSCOPY (4 Å) | | Cite: | Decoding the centromeric nucleosome through CENP-N.
Elife, 6, 2017
|
|
8FW7
 | | Histone from Bdellovibrio bacteriovorus bound to dsDNA | | Descriptor: | CBFD_NFYB_HMF domain-containing protein, DNA (5'-D(P*AP*T)-3'), DNA (5'-D(P*CP*AP*T)-3') | | Authors: | Laursen, S.P, Luger, K. | | Deposit date: | 2023-01-20 | | Release date: | 2023-08-30 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Histones with an unconventional DNA-binding mode in vitro are major chromatin constituents in the bacterium Bdellovibrio bacteriovorus.
Nat Microbiol, 8, 2023
|
|
8FVX
 | | Histone from Bdellovibrio bacteriovorus | | Descriptor: | CBFD_NFYB_HMF domain-containing protein | | Authors: | Laursen, S.P, Luger, K. | | Deposit date: | 2023-01-19 | | Release date: | 2023-08-30 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Histones with an unconventional DNA-binding mode in vitro are major chromatin constituents in the bacterium Bdellovibrio bacteriovorus.
Nat Microbiol, 8, 2023
|
|
5T5K
 | | Structure of histone-based chromatin in Archaea | | Descriptor: | CACODYLATE ION, DNA (90-MER), DNA-binding protein HMf-2 | | Authors: | Bhattacharyya, S, Mattiroli, F, Dyer, P.N, Sandman, K, Reeve, J.N, Luger, K. | | Deposit date: | 2016-08-31 | | Release date: | 2017-08-23 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (4 Å) | | Cite: | Structure of histone-based chromatin in Archaea.
Science, 357, 2017
|
|
4XZQ
 | | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | | Deposit date: | 2015-02-04 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF.
Mol.Cell.Biol., 35, 2015
|
|
8UA7
 | | Medusavirus Nucleosome Core Particle | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Toner, C.M, Hoitsma, N.M, Weerawarana, S, Luger, K. | | Deposit date: | 2023-09-20 | | Release date: | 2024-10-30 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Characterization of Medusavirus encoded histones reveals nucleosome-like structures and a unique linker histone
Nat Commun, 15, 2024
|
|
7U46
 | |
7U47
 | |
7U4D
 | |
6UPL
 | | Structure of FACT_subnucleosome complex 2 | | Descriptor: | DNA (79-mer), FACT complex subunit SPT16, FACT complex subunit SSRP1, ... | | Authors: | Zhou, K, Tan, Y.Z, Wei, H, Liu, Y, Carragher, B, Potter, C, Luger, K. | | Deposit date: | 2019-10-17 | | Release date: | 2019-12-11 | | Last modified: | 2024-03-20 | | Method: | ELECTRON MICROSCOPY (7.4 Å) | | Cite: | FACT caught in the act of manipulating the nucleosome.
Nature, 577, 2020
|
|
6UPK
 | | Structure of FACT_subnucleosome complex 1 | | Descriptor: | DNA (79-mer), FACT complex subunit SPT16, FACT complex subunit SSRP1, ... | | Authors: | Zhou, K, Tan, Y.Z, Wei, H, Liu, Y, Carragher, B, Potter, C, Luger, K. | | Deposit date: | 2019-10-17 | | Release date: | 2019-12-11 | | Last modified: | 2024-03-20 | | Method: | ELECTRON MICROSCOPY (4.9 Å) | | Cite: | FACT caught in the act of manipulating the nucleosome.
Nature, 577, 2020
|
|
3C1B
 | | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | | Deposit date: | 2008-01-22 | | Release date: | 2008-10-07 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
|
|
3C1C
 | | The effect of H3 K79 dimethylation and H4 K20 trimethylation on nucleosome and chromatin structure | | Descriptor: | Histone 2, H2bf, Histone H2A type 1, ... | | Authors: | Lu, X, Simon, M, Chodaparambil, J, Hansen, J, Shokat, K, Luger, K. | | Deposit date: | 2008-01-22 | | Release date: | 2008-10-07 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | The effect of H3K79 dimethylation and H4K20 trimethylation on nucleosome and chromatin structure.
Nat.Struct.Mol.Biol., 15, 2008
|
|
2FJ7
 | | Crystal structure of Nucleosome Core Particle Containing a Poly (dA.dT) Sequence Element | | Descriptor: | 147 bp DNA containing 16 bp poly dA element, 147 bp DNA containing 16 bp poly dT element, Histone H2B, ... | | Authors: | Bao, Y, White, C.L, Luger, K. | | Deposit date: | 2005-12-31 | | Release date: | 2006-09-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Nucleosome Core Particles Containing a Poly(dA.dT) Sequence Element Exhibit a Locally Distorted DNA Structure.
J.Mol.Biol., 361, 2006
|
|
2ZD7
 | |
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1EYN
 | | Structure of mura liganded with the extrinsic fluorescence probe ANS | | Descriptor: | 8-ANILINO-1-NAPHTHALENE SULFONATE, GLYCEROL, UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASE | | Authors: | Schonbrunn, E, Eschenburg, S, Luger, K, Kabsch, W, Amrhein, N. | | Deposit date: | 2000-05-07 | | Release date: | 2000-06-09 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the interaction of the fluorescence probe 8-anilino-1-naphthalene sulfonate (ANS) with the antibiotic target MurA.
Proc.Natl.Acad.Sci.USA, 97, 2000
|
|
4YS3
 | | Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | | Deposit date: | 2015-03-16 | | Release date: | 2015-10-14 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF.
Mol.Cell.Biol., 35, 2015
|
|
6USJ
 | | Structure of two nucleosomes bridged by human PARP2 | | Descriptor: | Histone H2A, Histone H2B type 1-J, Histone H3.1, ... | | Authors: | Gaullier, G, Bowerman, S, Luger, K. | | Deposit date: | 2019-10-27 | | Release date: | 2020-10-14 | | Last modified: | 2024-03-06 | | Method: | ELECTRON MICROSCOPY (10.5 Å) | | Cite: | Bridging of nucleosome-proximal DNA double-strand breaks by PARP2 enhances its interaction with HPF1.
Plos One, 15, 2020
|
|
