1IJW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ijw by Molmil](/molmil-images/mine/1ijw) | Testing the Water-Mediated Hin Recombinase DNA Recognition by Systematic Mutations. | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*(CBR)P*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*GP*A)-3', ... | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-04-30 | Release date: | 2002-02-22 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
5E3M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3m by Molmil](/molmil-images/mine/5e3m) | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
1J5N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1j5n by Molmil](/molmil-images/mine/1j5n) | Solution Structure of the Non-Sequence-Specific HMGB protein NHP6A in complex with SRY DNA | Descriptor: | 5'-D(*CP*TP*GP*AP*AP*CP*AP*AP*TP*CP*AP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*TP*GP*AP*TP*TP*GP*TP*TP*CP*AP*G)-3', Nonhistone chromosomal protein 6A | Authors: | Masse, J.E, Wong, B, Yen, Y.-M, Allain, F.H.-T, Johnson, R.C, Feigon, J. | Deposit date: | 2002-05-15 | Release date: | 2002-10-16 | Last modified: | 2023-12-27 | Method: | SOLUTION NMR | Cite: | The S. cerevisiae architectural HMGB protein NHP6A complexed with DNA: DNA and protein conformational changes upon binding J.Mol.Biol., 323, 2002
|
|
6P0U
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6p0u by Molmil](/molmil-images/mine/6p0u) | Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2019-05-17 | Release date: | 2019-06-19 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res., 47, 2019
|
|
6P0T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6p0t by Molmil](/molmil-images/mine/6p0t) | Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2019-05-17 | Release date: | 2019-06-19 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.603 Å) | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res., 47, 2019
|
|
6P0S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6p0s by Molmil](/molmil-images/mine/6p0s) | Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2019-05-17 | Release date: | 2019-06-19 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res., 47, 2019
|
|
5DTD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5dtd by Molmil](/molmil-images/mine/5dtd) | |
5E3L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3l by Molmil](/molmil-images/mine/5e3l) | |
5DS9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ds9 by Molmil](/molmil-images/mine/5ds9) | |
5E3N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3n by Molmil](/molmil-images/mine/5e3n) | |
5E3O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3o by Molmil](/molmil-images/mine/5e3o) | |
4FIS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4fis by Molmil](/molmil-images/mine/4fis) | THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING | Descriptor: | FACTOR FOR INVERSION STIMULATION (FIS) | Authors: | Yuan, H.S, Finkel, S.E, Feng, J.-A, Johnson, R.C, Dickerson, R.E. | Deposit date: | 1991-08-12 | Release date: | 1993-10-31 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | The molecular structure of wild-type and a mutant Fis protein: relationship between mutational changes and recombinational enhancer function or DNA binding. Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
6DGC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6dgc by Molmil](/molmil-images/mine/6dgc) | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | Deposit date: | 2018-05-17 | Release date: | 2018-07-18 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.92 Å) | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition. Elife, 7, 2018
|
|
6DGB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6dgb by Molmil](/molmil-images/mine/6dgb) | Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase | Descriptor: | IS607 family transposase IS1535 | Authors: | Chen, W.Y, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2018-05-17 | Release date: | 2018-07-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.52 Å) | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition. Elife, 7, 2018
|
|
4IHW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ihw by Molmil](/molmil-images/mine/4ihw) | |
4IHY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ihy by Molmil](/molmil-images/mine/4ihy) | |
3FIS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3fis by Molmil](/molmil-images/mine/3fis) | THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING | Descriptor: | FACTOR FOR INVERSION STIMULATION (FIS) | Authors: | Yuan, H.S, Finkel, S.E, Feng, J-A, Johnson, R.C, Dickerson, R.E. | Deposit date: | 1991-08-12 | Release date: | 1993-10-31 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | The molecular structure of wild-type and a mutant Fis protein: relationship between mutational changes and recombinational enhancer function or DNA binding. Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
4IHX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ihx by Molmil](/molmil-images/mine/4ihx) | |
4IHV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ihv by Molmil](/molmil-images/mine/4ihv) | |
2OG0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2og0 by Molmil](/molmil-images/mine/2og0) | Crystal Structure of the Lambda Xis-DNA complex | Descriptor: | 5'-D(*AP*AP*AP*CP*AP*GP*AP*CP*TP*AP*CP*AP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*TP*AP*TP*TP*AP*TP*GP*TP*AP*GP*TP*CP*TP*GP*TP*TP*T)-3', Excisionase | Authors: | Papagiannis, C.V, Sam, M.D, Abbani, M.A, Cascio, D, Yoo, D, Clubb, R.T, Johnson, R.C. | Deposit date: | 2007-01-04 | Release date: | 2007-03-13 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Fis targets assembly of the xis nucleoprotein filament to promote excisive recombination by phage lambda. J.Mol.Biol., 367, 2007
|
|
1JJ6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jj6 by Molmil](/molmil-images/mine/1jj6) | Testing the Water-Mediated Hin Recombinase DNA Recognition by Systematic Mutations. | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*CP*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*(5IT)P*TP*TP*TP*GP*AP*TP*AP*AP*GP*A)-3', ... | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-07-03 | Release date: | 2002-02-22 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
1JKO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jko by Molmil](/molmil-images/mine/1jko) | Testing the Water-Mediated HIN Recombinase DNA Recognition by Systematic Mutations | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*CP*TP*TP*AP*CP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*GP*TP*AP*AP*GP*A)-3', ... | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-07-12 | Release date: | 2002-02-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.24 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
1JKR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jkr by Molmil](/molmil-images/mine/1jkr) | Testing the Water-Mediated HIN Recombinase DNA Recognition by Systematic Mutations | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*CP*TP*TP*GP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*AP*CP*AP*AP*GP*A)-3', ... | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-07-13 | Release date: | 2002-02-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.28 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
1JKP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jkp by Molmil](/molmil-images/mine/1jkp) | Testing the Water-Mediated HIN Recombinase DNA Recognition by Systematic Mutations | Descriptor: | 5'-D(*AP*TP*CP*TP*TP*CP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*AP*GP*AP*AP*GP*A)-3', DNA-INVERTASE HIN | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-07-13 | Release date: | 2002-02-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|
1JKQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jkq by Molmil](/molmil-images/mine/1jkq) | Testing the Water-Mediated HIN Recombinase DNA Recognition by Systematic Mutations | Descriptor: | 5'-D(*AP*TP*CP*TP*TP*AP*TP*AP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*TP*AP*TP*AP*AP*GP*A)-3', DNA-INVERTASE HIN | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | Deposit date: | 2001-07-13 | Release date: | 2002-02-22 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.86 Å) | Cite: | Testing water-mediated DNA recognition by the Hin recombinase. EMBO J., 21, 2002
|
|