6PT2
 
 | | Crystal structure of the active delta opioid receptor in complex with the peptide agonist KGCHM07 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHOLESTEROL, Delta opioid receptor, ... | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
8XVV
 | | The TRRAP module of human NuA4/TIP60 complex | | Descriptor: | INOSITOL HEXAKISPHOSPHATE, Isoform 2 of E1A-binding protein p400, Isoform 2 of Transformation/transcription domain-associated protein | | Authors: | Chen, K, Wang, L, Yu, Z, Yu, J, Ren, Y, Wang, Q, Xu, Y. | | Deposit date: | 2024-01-15 | | Release date: | 2024-07-24 | | Last modified: | 2024-09-11 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | Structure of the human TIP60 complex.
Nat Commun, 15, 2024
|
|
6PT3
 | | Crystal structure of the active delta opioid receptor in complex with the small molecule agonist DPI-287 | | Descriptor: | 4-[(R)-[(2S,5R)-4-benzyl-2,5-dimethylpiperazin-1-yl](3-hydroxyphenyl)methyl]-N,N-diethylbenzamide, Delta opioid receptor | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
8XVT
 | | The core subcomplex of human NuA4/TIP60 complex | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Actin, cytoplasmic 1, ... | | Authors: | Chen, K, Wang, L, Yu, Z, Yu, J, Ren, Y, Wang, Q, Xu, Y. | | Deposit date: | 2024-01-15 | | Release date: | 2024-07-24 | | Last modified: | 2024-09-11 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | Structure of the human TIP60 complex.
Nat Commun, 15, 2024
|
|
8XVG
 | | Structure of human NuA4/TIP60 complex | | Descriptor: | ACTB protein (Fragment), ADENOSINE-5'-DIPHOSPHATE, Actin-like protein 6A, ... | | Authors: | Chen, K, Wang, L, Yu, Z, Yu, J, Ren, Y, Wang, Q, Xu, Y. | | Deposit date: | 2024-01-15 | | Release date: | 2024-07-24 | | Last modified: | 2024-09-11 | | Method: | ELECTRON MICROSCOPY (9.4 Å) | | Cite: | Structure of the human TIP60 complex.
Nat Commun, 15, 2024
|
|
5AXM
 | | Crystal structure of Thg1 like protein (TLP) with tRNA(Phe) | | Descriptor: | MAGNESIUM ION, RNA (75-MER), tRNA(His)-5'-guanylyltransferase (Thg1) like protein | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.21 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
5AXK
 | | Crystal structure of Thg1 like protein (TLP) | | Descriptor: | GLYCEROL, tRNA(His)-5'-guanylyltransferase (Thg1) like protein | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.29 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
5AXN
 | | Crystal structure of Thg1 like protein (TLP) with tRNA(Phe) and GDPNP | | Descriptor: | MAGNESIUM ION, PHOSPHOAMINOPHOSPHONIC ACID-GUANYLATE ESTER, RNA (75-MER), ... | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.703 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1ROQ
 | |
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
5AXL
 | | Crystal structure of Thg1 like protein (TLP) with GTP | | Descriptor: | GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, tRNA(His)-5'-guanylyltransferase (Thg1) like protein | | Authors: | Kimura, S, Suzuki, T, Yu, J, Kato, K, Yao, M. | | Deposit date: | 2015-07-31 | | Release date: | 2016-08-03 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.998 Å) | | Cite: | Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein
Sci Adv, 2, 2016
|
|
3Q61
 | | 3'-Fluoro Hexitol Nucleic Acid DNA Structure | | Descriptor: | DNA (5'-D(*GP*CP*GP*TP*AP*(F3H)P*AP*CP*GP*C)-3') | | Authors: | Seth, P.R, Allerson, C.R, Prakash, T.P, Siwkowski, A, Berdeja, A, Yu, J, Pallan, P.S, Watt, A.T, Gaus, H, Bhat, B, Egli, M, Swayze, E.E. | | Deposit date: | 2010-12-30 | | Release date: | 2012-01-18 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.56 Å) | | Cite: | Synthesis, improved antisense activity and structural rationale for the divergent RNA affinities of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides.
J.Am.Chem.Soc., 133, 2011
|
|
3WGM
 | | STAPHYLOCOCCUS AUREUS FTSZ T7 mutant substituted for GAN bound with GTP, DeltaT7GAN-GTP | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION | | Authors: | Han, X, Matsui, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-08-06 | | Release date: | 2013-12-25 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.091 Å) | | Cite: | Structural change in FtsZ Induced by intermolecular interactions between bound GTP and the T7 loop
J.Biol.Chem., 289, 2014
|
|
3WBI
 | | Crystal structure analysis of eukaryotic translation initiation factor 5B structure I | | Descriptor: | Eukaryotic translation initiation factor 5B | | Authors: | Zheng, A, Yamamoto, R, Ose, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-05-20 | | Release date: | 2014-11-19 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | X-ray structures of eIF5B and the eIF5B-eIF1A complex: the conformational flexibility of eIF5B is restricted on the ribosome by interaction with eIF1A
Acta Crystallogr.,Sect.D, 70, 2014
|
|
3G5U
 | | Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding | | Descriptor: | MERCURY (II) ION, Multidrug resistance protein 1a | | Authors: | Aller, S.G, Yu, J, Ward, A, Weng, Y, Chittaboina, S, Zhuo, R, Harrell, P.M, Trinh, Y.T, Zhang, Q, Urbatsch, I.L, Chang, G. | | Deposit date: | 2009-02-05 | | Release date: | 2009-03-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.8 Å) | | Cite: | Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding.
Science, 323, 2009
|
|
6DW1
 | | Cryo-EM structure of the benzodiazepine-sensitive alpha1beta1gamma2S tri-heteromeric GABAA receptor in complex with GABA (ECD map) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, GAMMA-AMINO-BUTANOIC ACID, Gamma-aminobutyric acid receptor subunit alpha-1,Gamma-aminobutyric acid receptor subunit alpha-1, ... | | Authors: | Phulera, S, Zhu, H, Yu, J, Yoshioka, C, Gouaux, E. | | Deposit date: | 2018-06-26 | | Release date: | 2018-08-08 | | Last modified: | 2024-10-23 | | Method: | ELECTRON MICROSCOPY (3.1 Å) | | Cite: | Cryo-EM structure of the benzodiazepine-sensitive alpha 1 beta 1 gamma 2S tri-heteromeric GABAAreceptor in complex with GABA.
Elife, 7, 2018
|
|
6DW0
 | | Cryo-EM structure of the benzodiazepine-sensitive alpha1beta1gamma2S tri-heteromeric GABAA receptor in complex with GABA (Whole map) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, GAMMA-AMINO-BUTANOIC ACID, Gamma-aminobutyric acid receptor subunit alpha-1,Gamma-aminobutyric acid receptor subunit alpha-1, ... | | Authors: | Phulera, S, Zhu, H, Yu, J, Yoshioka, C, Gouaux, E. | | Deposit date: | 2018-06-26 | | Release date: | 2018-08-08 | | Last modified: | 2024-11-20 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Cryo-EM structure of the benzodiazepine-sensitive alpha 1 beta 1 gamma 2S tri-heteromeric GABAAreceptor in complex with GABA.
Elife, 7, 2018
|
|
3G61
 | | Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding | | Descriptor: | (4S,11S,18S)-4,11,18-tri(propan-2-yl)-6,13,20-triselena-3,10,17,22,23,24-hexaazatetracyclo[17.2.1.1~5,8~.1~12,15~]tetracosa-1(21),5(24),7,12(23),14,19(22)-hexaene-2,9,16-trione, Multidrug resistance protein 1a | | Authors: | Aller, S.G, Yu, J, Ward, A, Weng, Y, Chittaboina, S, Zhuo, R, Harrell, P.M, Trinh, Y.T, Zhang, Q, Urbatsch, I.L, Chang, G. | | Deposit date: | 2009-02-05 | | Release date: | 2009-03-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.35 Å) | | Cite: | Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding.
Science, 323, 2009
|
|
3G60
 | | Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding | | Descriptor: | (4R,11R,18R)-4,11,18-tri(propan-2-yl)-6,13,20-triselena-3,10,17,22,23,24-hexaazatetracyclo[17.2.1.1~5,8~.1~12,15~]tetracosa-1(21),5(24),7,12(23),14,19(22)-hexaene-2,9,16-trione, Multidrug resistance protein 1a | | Authors: | Aller, S.G, Yu, J, Ward, A, Weng, Y, Chittaboina, S, Zhuo, R, Harrell, P.M, Trinh, Y.T, Zhang, Q, Urbatsch, I.L, Chang, G. | | Deposit date: | 2009-02-05 | | Release date: | 2009-03-24 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.4 Å) | | Cite: | Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding.
Science, 323, 2009
|
|
3WBK
 | | crystal structure analysis of eukaryotic translation initiation factor 5B and 1A complex | | Descriptor: | Eukaryotic translation initiation factor 1A, Eukaryotic translation initiation factor 5B | | Authors: | Zheng, A, Yamamoto, R, Ose, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-05-20 | | Release date: | 2014-11-19 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | X-ray structures of eIF5B and the eIF5B-eIF1A complex: the conformational flexibility of eIF5B is restricted on the ribosome by interaction with eIF1A
Acta Crystallogr.,Sect.D, 70, 2014
|
|
9L8K
 | | Rhodothermus marines cellobiose 2-epimerase RmCE in complex with mannobiitol | | Descriptor: | CHLORIDE ION, Cellobiose 2-epimerase, D-MANNITOL, ... | | Authors: | Saburi, W, Muto, H, Jaito, N, Kato, K, Yu, J, Yao, M, Mori, H. | | Deposit date: | 2024-12-27 | | Release date: | 2025-07-23 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Biochemical and structural analysis of the mechanism for the catalysis and specificity of cellobiose 2-epimerase from Rhodothermus marinus.
Biosci.Biotechnol.Biochem., 89, 2025
|
|
9L8I
 | | Rhodothermus marines cellobiose 2-epimerase RmCE in complex with mannobiose | | Descriptor: | CHLORIDE ION, Cellobiose 2-epimerase, PHOSPHATE ION, ... | | Authors: | Saburi, W, Muto, H, Jaito, N, Kato, K, Yu, J, Yao, M, Mori, H. | | Deposit date: | 2024-12-27 | | Release date: | 2025-07-23 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Biochemical and structural analysis of the mechanism for the catalysis and specificity of cellobiose 2-epimerase from Rhodothermus marinus.
Biosci.Biotechnol.Biochem., 89, 2025
|
|
3W9Z
 | | Crystal structure of DusC | | Descriptor: | FLAVIN MONONUCLEOTIDE, tRNA-dihydrouridine synthase C | | Authors: | Chen, M, Yu, J, Tanaka, Y, Tanaka, I, Yao, M. | | Deposit date: | 2013-04-19 | | Release date: | 2013-07-31 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Structure of dihydrouridine synthase C (DusC) from Escherichia coli
Acta Crystallogr.,Sect.F, 69, 2013
|
|
3WGL
 | | STAPHYLOCOCCUS AUREUS FTSZ T7 mutant substituted for GAN bound with GDP, DeltaT7GAN-GDP | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-DIPHOSPHATE | | Authors: | Han, X, Matsui, T, Yu, J, Tanaka, I, Yao, M. | | Deposit date: | 2013-08-06 | | Release date: | 2013-12-25 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (3.066 Å) | | Cite: | Structural change in FtsZ Induced by intermolecular interactions between bound GTP and the T7 loop
J.Biol.Chem., 289, 2014
|
|
