1YMU
 
 | |
264D
 | | THREE-DIMENSIONAL CRYSTAL STRUCTURE OF THE A-TRACT DNA DODECAMER D(CGCAAATTTGCG) COMPLEXED WITH THE MINOR-GROOVE-BINDING DRUG HOECHST 33258 | | Descriptor: | 2'-(4-HYDROXYPHENYL)-5-(4-METHYL-1-PIPERAZINYL)-2,5'-BI-BENZIMIDAZOLE, DNA (5'-D(*CP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*G)-3') | | Authors: | Vega, M.C, Garcia-Saez, I, Aymami, J, Eritja, R, Van Der Marel, G.A, Van Boom, J.H, Rich, A, Coll, M. | | Deposit date: | 1994-09-22 | | Release date: | 1995-03-31 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.44 Å) | | Cite: | Three-dimensional crystal structure of the A-tract DNA dodecamer d(CGCAAATTTGCG) complexed with the minor-groove-binding drug Hoechst 33258.
Eur.J.Biochem., 222, 1994
|
|
2CDM
 | | The structure of TrwC complexed with a 27-mer DNA comprising the recognition hairpin and the cleavage site | | Descriptor: | 5'-D(*GP*CP*GP*CP*AP*CP*CP*GP*AP*AP *AP*GP*GP*TP*GP*CP*GP*TP*AP*TP*TP*GP*TP*CP*TP*AP*T)-3', SULFATE ION, TRWC | | Authors: | Boer, R, Russi, S, Guasch, A, Lucas, M, Blanco, A.G, Perez-Luque, R, Coll, M, de la Cruz, F. | | Deposit date: | 2006-01-25 | | Release date: | 2006-07-31 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Unveiling the Molecular Mechanism of a Conjugative Relaxase: The Structure of Trwc Complexed with a 27-mer DNA Comprising the Recognition Hairpin and the Cleavage Site.
J.Mol.Biol., 358, 2006
|
|
467D
 | |
2CPG
 | | TRANSCRIPTIONAL REPRESSOR COPG | | Descriptor: | CHLORIDE ION, TRANSCRIPTIONAL REPRESSOR COPG | | Authors: | Gomis-Rueth, F.X, Sola, M, Acebo, P, Parraga, A, Guasch, A, Eritja, R, Gonzalez, A, Espinosa, M, del Solar, G, Coll, M. | | Deposit date: | 1999-11-15 | | Release date: | 1999-11-19 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | The structure of plasmid-encoded transcriptional repressor CopG unliganded and bound to its operator.
EMBO J., 17, 1998
|
|
1PCA
 | | THREE DIMENSIONAL STRUCTURE OF PORCINE PANCREATIC PROCARBOXYPEPTIDASE A. A COMPARISON OF THE A AND B ZYMOGENS AND THEIR DETERMINANTS FOR INHIBITION AND ACTIVATION | | Descriptor: | CITRIC ACID, PROCARBOXYPEPTIDASE A PCPA, VALINE, ... | | Authors: | Guasch, A, Coll, M, Aviles, F.X, Huber, R. | | Deposit date: | 1991-10-28 | | Release date: | 1993-10-31 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Three-dimensional structure of porcine pancreatic procarboxypeptidase A. A comparison of the A and B zymogens and their determinants for inhibition and activation.
J.Mol.Biol., 224, 1992
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
3ZZJ
 | | Structure of an engineered aspartate aminotransferase | | Descriptor: | ASPARTATE AMINOTRANSFERASE, BETA-MERCAPTOETHANOL, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Fernandez, F.J, deVries, D, Pena-Soler, E, Coll, M, Christen, P, Gehring, H, Vega, M.C. | | Deposit date: | 2011-09-01 | | Release date: | 2011-12-28 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Structure and Mechanism of a Cysteine Sulfinate Desulfinase Engineered on the Aspartate Aminotransferase Scaffold.
Biocim.Biophys.Acta, 1824, 2011
|
|
1GNX
 | | b-glucosidase from Streptomyces sp | | Descriptor: | BETA-GLUCOSIDASE, SULFATE ION, beta-D-fructofuranose-(2-1)-alpha-D-glucopyranose | | Authors: | Guasch, A, Perez-Pons, J.A, Vallmitjana, M, Querol, E, Coll, M. | | Deposit date: | 2001-10-10 | | Release date: | 2002-10-17 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.68 Å) | | Cite: | Beta-Glucosidase from Streptomyces
To be Published
|
|
4A00
 | | Structure of an engineered aspartate aminotransferase | | Descriptor: | ALANYL-PYRIDOXAL-5'-PHOSPHATE, ASPARTATE AMINOTRANSFERASE, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Fernandez, F.J, deVries, D, Pena-Soler, E, Coll, M, Christen, P, Gehring, H, Vega, M.C. | | Deposit date: | 2011-09-06 | | Release date: | 2011-12-28 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.34 Å) | | Cite: | Structure and Mechanism of a Cysteine Sulfinate Desulfinase Engineered on the Aspartate Aminotransferase Scaffold.
Biocim.Biophys.Acta, 1824, 2011
|
|
1GON
 | | b-glucosidase from Streptomyces sp | | Descriptor: | BETA-GLUCOSIDASE, MERCURY (II) ION, SULFATE ION | | Authors: | Guasch, A, Perez-Pons, J.A, Vallmitjana, M, Querol, E, Coll, M. | | Deposit date: | 2001-10-22 | | Release date: | 2002-11-07 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal Structure of a Family 1 Beta-Glucosidase from Streptomyces
To be Published
|
|
3ZZK
 | | Structure of an engineered aspartate aminotransferase | | Descriptor: | 4'-DEOXY-4'-AMINOPYRIDOXAL-5'-PHOSPHATE, ASPARTATE AMINOTRANSFERASE, GLYCEROL, ... | | Authors: | Fernandez, F.J, deVries, D, Pena-Soler, E, Coll, M, Christen, P, Gehring, H, Vega, M.C. | | Deposit date: | 2011-09-01 | | Release date: | 2011-12-28 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.78 Å) | | Cite: | Structure and Mechanism of a Cysteine Sulfinate Desulfinase Engineered on the Aspartate Aminotransferase Scaffold.
Biocim.Biophys.Acta, 1824, 2011
|
|
1HEY
 | |
1H8L
 | | Duck Carboxypeptidase D Domain II in complex with GEMSA | | Descriptor: | (2-GUANIDINOETHYLMERCAPTO)SUCCINIC ACID, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Gomis-Rueth, F.X, Coll, M, Aviles, F.X, Vendrell, J, Fricker, L.D. | | Deposit date: | 2001-02-09 | | Release date: | 2002-02-08 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The crystal structure of the inhibitor-complexed carboxypeptidase D domain II and the modeling of regulatory carboxypeptidases.
J. Biol. Chem., 276, 2001
|
|
1GTI
 | | MODIFIED GLUTATHIONE S-TRANSFERASE (PI) COMPLEXED WITH S (P-NITROBENZYL)GLUTATHIONE | | Descriptor: | GLUTATHIONE S-TRANSFERASE, S-(P-NITROBENZYL)GLUTATHIONE | | Authors: | Vega, M.C, Coll, M. | | Deposit date: | 1998-01-09 | | Release date: | 1999-03-02 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The three-dimensional structure of Cys-47-modified mouse liver glutathione S-transferase P1-1. Carboxymethylation dramatically decreases the affinity for glutathione and is associated with a loss of electron density in the alphaB-310B region.
J.Biol.Chem., 273, 1998
|
|
1GL7
 | | Plasmid coupling protein TrwB in complex with the non-hydrolisable ATP-analogue ADPNP. | | Descriptor: | CHLORIDE ION, CONJUGAL TRANSFER PROTEIN TRWB, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | | Deposit date: | 2001-08-28 | | Release date: | 2002-05-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase
Nature, 409, 2001
|
|
1GKI
 | | Plasmid coupling protein TrwB in complex with ADP and Mg2+. | | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ADENOSINE-5'-DIPHOSPHATE, CONJUGAL TRANSFER PROTEIN TRWB, ... | | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | | Deposit date: | 2001-08-14 | | Release date: | 2002-05-16 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase
Nature, 409, 2001
|
|
1QX0
 | | CONJUGATIVE RELAXASE TRWC IN COMPLEX WITH ORIT DNA. METAL-BOUND STRUCTURE | | Descriptor: | DNA OLIGONUCLEOTIDE, SULFATE ION, ZINC ION, ... | | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Prez-Luque, R, Gomis-Rth, F.X, de la Cruz, F, Coll, M. | | Deposit date: | 2003-09-04 | | Release date: | 2003-11-25 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.26 Å) | | Cite: | RECOGNITION AND PROCESSING OF THE ORIGIN OF TRANSFER DNA BY CONJUGATIVE RELAXASE TRWC
Nat.Struct.Biol., 10, 2003
|
|
1S6M
 | | Conjugative Relaxase Trwc In Complex With Orit DNA. Metal-Bound Structure | | Descriptor: | DNA (25-MER), NICKEL (II) ION, TrwC | | Authors: | Guasch, A, Lucas, M, Moncalian, G, Cabezas, M, Perez-Luque, R, Gomis-Ruth, F.X, de la Cruz, F, Coll, M. | | Deposit date: | 2004-01-26 | | Release date: | 2005-06-14 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.28 Å) | | Cite: | Unveiling the molecular mechanism of a conjugative relaxase: The structure of TrwC complexed with a 27-mer DNA comprising the recognition hairpin and the cleavage site.
J.Mol.Biol., 358, 2006
|
|
1RNF
 | | X-RAY CRYSTAL STRUCTURE OF UNLIGANDED HUMAN RIBONUCLEASE 4 | | Descriptor: | PROTEIN (RIBONUCLEASE 4) | | Authors: | Terzyan, S.S, Peracaula, R, De Llorens, R, Tsushima, Y, Yamada, H, Seno, M, Gomis-Rueth, F.X, Coll, M. | | Deposit date: | 1998-10-29 | | Release date: | 1999-10-29 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | The three-dimensional structure of human RNase 4, unliganded and complexed with d(Up), reveals the basis for its uridine selectivity.
J.Mol.Biol., 285, 1999
|
|
2FIP
 | | Phage phi29 transcription regulator p4 | | Descriptor: | Late genes activator | | Authors: | Badia, D, Camacho, A, Perez-Lago, L, Escandon, C, Salas, M, Coll, M. | | Deposit date: | 2005-12-30 | | Release date: | 2006-09-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The structure of phage phi29 transcription regulator p4-DNA complex reveals an N-hook motif for DNA
Mol.Cell, 22, 2006
|
|
2FIO
 | | Phage phi29 transcription regulator p4-DNA complex | | Descriptor: | DNA (41-MER), Late genes activator | | Authors: | Badia, D, Camacho, A, Perez-Lago, L, Escandon, C, Salas, M, Coll, M. | | Deposit date: | 2005-12-30 | | Release date: | 2006-09-26 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | The structure of phage phi29 transcription regulator p4-DNA complex reveals an N-hook motif for DNA
Mol.Cell, 22, 2006
|
|
5NQ6
 | | Crystal structure of the inhibited form of the redox-sensitive SufE-like sulfur acceptor CsdE from Escherichia coli at 2.40 Angstrom Resolution | | Descriptor: | GLYCEROL, SULFATE ION, Sulfur acceptor protein CsdE | | Authors: | Penya-Soler, E, Aranda, J, Lopez-Estepa, M, Gomez, S, Garces, F, Coll, M, Fernandez, F.J, Vega, M.C. | | Deposit date: | 2017-04-19 | | Release date: | 2018-03-28 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Insights into the inhibited form of the redox-sensitive SufE-like sulfur acceptor CsdE.
PLoS ONE, 12, 2017
|
|
1Z3F
 | | Structure of ellipticine in complex with a 6-bp DNA | | Descriptor: | 5'-D(*CP*GP*AP*TP*CP*G)-3', COBALT (II) ION, ELLIPTICINE | | Authors: | Canals, A, Purciolas, M, Aymami, J, Coll, M. | | Deposit date: | 2005-03-12 | | Release date: | 2005-07-19 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | The anticancer agent ellipticine unwinds DNA by intercalative binding in an orientation parallel to base pairs.
Acta Crystallogr.,Sect.D, 61, 2005
|
|
1H8X
 | | Domain-swapped Dimer of a Human Pancreatic Ribonuclease Variant | | Descriptor: | RIBONUCLEASE 1 | | Authors: | Canals, A, Pous, J, Guasch, A, Benito, A, Ribo, M, Vilanova, M, Coll, M. | | Deposit date: | 2001-02-16 | | Release date: | 2002-02-14 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The Structure of an Engineered Domain-Swapped Ribonuclease Dimer and its Implications for the Evolution of Proteins Toward Oligomerization
Structure, 9, 2001
|
|
