4P0R
 
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
1B73
 | | GLUTAMATE RACEMASE FROM AQUIFEX PYROPHILUS | | Descriptor: | GLUTAMATE RACEMASE | | Authors: | Hwang, K.Y, Cho, C.S, Kim, S.S, Yu, Y.G, Cho, Y. | | Deposit date: | 1999-01-26 | | Release date: | 1999-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure and mechanism of glutamate racemase from Aquifex pyrophilus.
Nat.Struct.Biol., 6, 1999
|
|
1B74
 | | GLUTAMATE RACEMASE FROM AQUIFEX PYROPHILUS | | Descriptor: | D-GLUTAMINE, GLUTAMATE RACEMASE | | Authors: | Hwang, K.Y, Cho, C.S, Kim, S.S, Yu, Y.G, Cho, Y. | | Deposit date: | 1999-01-27 | | Release date: | 2000-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structure and mechanism of glutamate racemase from Aquifex pyrophilus.
Nat.Struct.Biol., 6, 1999
|
|
7WRS
 | |
7WRU
 | |
7YXA
 | | XFEL crystal structure of the human sphingosine 1 phosphate receptor 5 in complex with ONO-5430608 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 2-acetamido-2-deoxy-beta-D-glucopyranose, 4-[6-(2-naphthalen-1-ylethoxy)-2,3,4,5-tetrahydro-1H-3-benzazepin-3-ium-3-yl]butanoic acid, ... | | Authors: | Lyapina, E, Marin, E, Gusach, A, Orekhov, P, Gerasimov, A, Luginina, A, Vakhrameev, D, Ergasheva, M, Kovaleva, M, Khusainov, G, Khorn, P, Shevtsov, M, Kovalev, K, Okhrimenko, I, Bukhdruker, S, Popov, P, Hu, H, Weierstall, U, Liu, W, Cho, Y, Gushchin, I, Rogachev, A, Bourenkov, G, Park, S, Park, G, Huyn, H.J, Park, J, Gordeliy, V, Borshchevskiy, V, Mishin, A, Cherezov, V. | | Deposit date: | 2022-02-15 | | Release date: | 2022-08-10 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structural basis for receptor selectivity and inverse agonism in S1P 5 receptors.
Nat Commun, 13, 2022
|
|
3T1I
 | | Crystal Structure of Human Mre11: Understanding Tumorigenic Mutations | | Descriptor: | 2,3-DIHYDROXY-1,4-DITHIOBUTANE, Double-strand break repair protein MRE11A, GLYCEROL, ... | | Authors: | Park, Y.B, Chae, J, Kim, Y, Cho, Y. | | Deposit date: | 2011-07-22 | | Release date: | 2011-11-30 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of human mre11: understanding tumorigenic mutations
Structure, 19, 2011
|
|
1GH6
 | | RETINOBLASTOMA POCKET COMPLEXED WITH SV40 LARGE T ANTIGEN | | Descriptor: | Large T antigen, Retinoblastoma-associated protein | | Authors: | Kim, H.Y, Cho, Y. | | Deposit date: | 2000-11-15 | | Release date: | 2001-11-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural basis for the inactivation of retinoblastoma tumor suppressor by SV40 large T antigen.
EMBO J., 20, 2001
|
|
5E9F
 | | Structural insights of isocitrate lyases from Magnaporthe oryzae | | Descriptor: | Isocitrate lyase, MAGNESIUM ION | | Authors: | Park, Y, Cho, Y, Lee, Y.-H, Lee, Y.-W, Rhee, S. | | Deposit date: | 2015-10-15 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure and functional analysis of isocitrate lyases from Magnaporthe oryzae and Fusarium graminearum
J.Struct.Biol., 194, 2016
|
|
5E9H
 | | Structural insights of isocitrate lyases from Fusarium graminearum | | Descriptor: | Isocitrate lyase, MALONATE ION, MANGANESE (II) ION | | Authors: | Park, Y, Cho, Y, Lee, Y.-H, Lee, Y.-W, Rhee, S. | | Deposit date: | 2015-10-15 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structure and functional analysis of isocitrate lyases from Magnaporthe oryzae and Fusarium graminearum
J.Struct.Biol., 194, 2016
|
|
5E9G
 | | Structural insights of isocitrate lyases from Magnaporthe oryzae | | Descriptor: | GLYCEROL, GLYOXYLIC ACID, Isocitrate lyase, ... | | Authors: | Park, Y, Cho, Y, Lee, Y.-H, Lee, Y.-W, Rhee, S. | | Deposit date: | 2015-10-15 | | Release date: | 2016-04-27 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Crystal structure and functional analysis of isocitrate lyases from Magnaporthe oryzae and Fusarium graminearum
J.Struct.Biol., 194, 2016
|
|
1X3Z
 | | Structure of a peptide:N-glycanase-Rad23 complex | | Descriptor: | UV excision repair protein RAD23, ZINC ION, beta-D-fructofuranose-(2-1)-alpha-D-glucopyranose, ... | | Authors: | Lee, J.-H, Choi, J.M, Lee, C, Yi, K.J, Cho, Y. | | Deposit date: | 2005-05-11 | | Release date: | 2005-06-14 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structure of a peptide:N-glycanase-Rad23 complex: insight into the deglycosylation for denatured glycoproteins.
Proc.Natl.Acad.Sci.Usa, 102, 2005
|
|
1X3W
 | | Structure of a peptide:N-glycanase-Rad23 complex | | Descriptor: | UV excision repair protein RAD23, ZINC ION, beta-D-fructofuranose-(2-1)-alpha-D-glucopyranose, ... | | Authors: | Lee, J.-H, Choi, J.M, Lee, C, Yi, K.J, Cho, Y. | | Deposit date: | 2005-05-11 | | Release date: | 2005-06-14 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structure of a peptide:N-glycanase-Rad23 complex: insight into the deglycosylation for denatured glycoproteins.
Proc.Natl.Acad.Sci.Usa, 102, 2005
|
|
7EWR
 | | Cryo-EM structure of human GPR158 in complex with RGS7-Gbeta5 in a 2:2:2 ratio | | Descriptor: | Guanine nucleotide-binding protein subunit beta-5, Probable G-protein coupled receptor 158, Regulator of G-protein signaling 7 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Cho, Y. | | Deposit date: | 2021-05-26 | | Release date: | 2021-12-01 | | Last modified: | 2022-02-16 | | Method: | ELECTRON MICROSCOPY (4.7 Å) | | Cite: | Structure of the class C orphan GPCR GPR158 in complex with RGS7-G beta 5.
Nat Commun, 12, 2021
|
|
7EWL
 | | cryo-EM structure of apo GPR158 | | Descriptor: | Probable G-protein coupled receptor 158 | | Authors: | Jeong, E, Kim, Y, Jeong, J, Cho, Y. | | Deposit date: | 2021-05-25 | | Release date: | 2021-12-01 | | Last modified: | 2022-02-16 | | Method: | ELECTRON MICROSCOPY (3.52 Å) | | Cite: | Structure of the class C orphan GPCR GPR158 in complex with RGS7-G beta 5.
Nat Commun, 12, 2021
|
|
7EWP
 | | Cryo-EM structure of human GPR158 in complex with RGS7-Gbeta5 in a 2:1:1 ratio | | Descriptor: | Guanine nucleotide-binding protein subunit beta-5, Probable G-protein coupled receptor 158, Regulator of G-protein signaling 7 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Cho, Y. | | Deposit date: | 2021-05-25 | | Release date: | 2021-12-01 | | Last modified: | 2022-02-16 | | Method: | ELECTRON MICROSCOPY (4.3 Å) | | Cite: | Structure of the class C orphan GPCR GPR158 in complex with RGS7-G beta 5.
Nat Commun, 12, 2021
|
|
3B64
 | |
1R6L
 | | Crystal Structure Of The tRNA Processing Enzyme Rnase pH From Pseudomonas Aeruginosa | | Descriptor: | 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, Ribonuclease PH, SULFATE ION | | Authors: | Choi, J.M, Park, E.Y, Kim, J.H, Chang, S.K, Cho, Y. | | Deposit date: | 2003-10-15 | | Release date: | 2004-02-17 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Probing the functional importance of the hexameric ring structure of RNase PH
J.BIOL.CHEM., 279, 2004
|
|
1R6M
 | | Crystal Structure Of The tRNA Processing Enzyme Rnase pH From Pseudomonas Aeruginosa In Complex With Phosphate | | Descriptor: | PHOSPHATE ION, Ribonuclease PH | | Authors: | Choi, J.M, Park, E.Y, Kim, J.H, Chang, S.K, Cho, Y. | | Deposit date: | 2003-10-15 | | Release date: | 2004-02-17 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Probing the functional importance of the hexameric ring structure of RNase PH
J.BIOL.CHEM., 279, 2004
|
|
7CA3
 | | Cryo-EM structure of human GABA(B) receptor bound to the positive allosteric modulator rac-BHFF | | Descriptor: | (3S)-5,7-ditert-butyl-3-oxidanyl-3-(trifluoromethyl)-1-benzofuran-2-one, CHOLESTEROL, Gamma-aminobutyric acid type B receptor subunit 1, ... | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-06-08 | | Release date: | 2020-11-11 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
7CA5
 | | Cryo-EM structure of human GABA(B) receptor in apo state | | Descriptor: | Gamma-aminobutyric acid type B receptor subunit 1, Gamma-aminobutyric acid type B receptor subunit 2 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-06-08 | | Release date: | 2020-11-11 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (7.6 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
7CUM
 | | Cryo-EM structure of human GABA(B) receptor bound to the antagonist CGP54626 | | Descriptor: | (R)-(cyclohexylmethyl)[(2S)-3-{[(1S)-1-(3,4-dichlorophenyl)ethyl]amino}-2-hydroxypropyl]phosphinic acid, CHOLESTEROL, Gamma-aminobutyric acid type B receptor subunit 1, ... | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-08-23 | | Release date: | 2020-11-11 | | Method: | ELECTRON MICROSCOPY (3.52 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
2NWG
 | | Structure of CXCL12:heparin disaccharide complex | | Descriptor: | 4-deoxy-2-O-sulfo-alpha-L-threo-hex-4-enopyranuronic acid-(1-4)-2-deoxy-6-O-sulfo-2-(sulfoamino)-alpha-D-glucopyranose, Stromal cell-derived factor 1 | | Authors: | Murphy, J.W, Cho, Y, Lolis, E. | | Deposit date: | 2006-11-14 | | Release date: | 2007-02-13 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Structural and Functional Basis of CXCL12 (Stromal Cell-derived Factor-1{alpha}) Binding to Heparin
J.Biol.Chem., 282, 2007
|
|
3TAL
 | | Crystal structure of NurA with manganese | | Descriptor: | DNA double-strand break repair protein nurA, GLYCEROL, MANGANESE (II) ION | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2013-07-03 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
3TAZ
 | | Crystal structure of NurA bound to dAMP and manganese | | Descriptor: | 2'-DEOXYADENOSINE-5'-MONOPHOSPHATE, DNA double-strand break repair protein nurA, GLYCEROL, ... | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
