1PYT
| TERNARY COMPLEX OF PROCARBOXYPEPTIDASE A, PROPROTEINASE E, AND CHYMOTRYPSINOGEN C | Descriptor: | CALCIUM ION, CHYMOTRYPSINOGEN C, PROCARBOXYPEPTIDASE A, ... | Authors: | Gomis-Ruth, F.X, Gomez, M, Bode, W, Huber, R, Aviles, F.X. | Deposit date: | 1995-06-21 | Release date: | 1997-01-27 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | The three-dimensional structure of the native ternary complex of bovine pancreatic procarboxypeptidase A with proproteinase E and chymotrypsinogen C. EMBO J., 14, 1995
|
|
1GL6
| Plasmid coupling protein TrwB in complex with the non-hydrolysable GTP analogue GDPNP | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ATPASE, CHLORIDE ION, ... | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | Deposit date: | 2001-08-28 | Release date: | 2002-05-16 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|
1GVL
| Human prokallikrein 6 (hK6)/ prozyme/ proprotease M/ proneurosin | Descriptor: | KALLIKREIN 6 | Authors: | Gomis-Ruth, F.X, Bayes, A, Sotiropoulou, G, Pampalakis, G, Tsetsenis, T, Villegas, V, Aviles, F.X, Coll, M. | Deposit date: | 2002-02-14 | Release date: | 2002-05-16 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | The Structure of Human Prokallikrein 6 Reveals a Novel Activation Mechanism for the Kallikrein Family. J.Biol.Chem., 277, 2002
|
|
1GKI
| Plasmid coupling protein TrwB in complex with ADP and Mg2+. | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, ADENOSINE-5'-DIPHOSPHATE, CONJUGAL TRANSFER PROTEIN TRWB, ... | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | Deposit date: | 2001-08-14 | Release date: | 2002-05-16 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|
1GL7
| Plasmid coupling protein TrwB in complex with the non-hydrolisable ATP-analogue ADPNP. | Descriptor: | CHLORIDE ION, CONJUGAL TRANSFER PROTEIN TRWB, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | Authors: | Gomis-Ruth, F.X, Moncalian, G, De La cruz, F, Coll, M. | Deposit date: | 2001-08-28 | Release date: | 2002-05-16 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The Bacterial Conjugation Protein Trwb Resembles Ring Helicases and F1-ATPase Nature, 409, 2001
|
|
1PEX
| COLLAGENASE-3 (MMP-13) C-TERMINAL HEMOPEXIN-LIKE DOMAIN | Descriptor: | CALCIUM ION, CHLORIDE ION, COLLAGENASE-3, ... | Authors: | Gomis-Ruth, F.X, Gohlke, U, Betz, M, Knauper, V, Murphy, G, Lopez-Otin, C, Bode, W. | Deposit date: | 1996-05-24 | Release date: | 1996-12-23 | Last modified: | 2024-06-05 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | The helping hand of collagenase-3 (MMP-13): 2.7 A crystal structure of its C-terminal haemopexin-like domain. J.Mol.Biol., 264, 1996
|
|
1H2C
| Ebola virus matrix protein VP40 N-terminal domain in complex with RNA (High-resolution VP40[55-194] variant). | Descriptor: | 5'-R(*UP*GP*AP)-3', MATRIX PROTEIN VP40 | Authors: | Gomis-Ruth, F.X, Dessen, A, Bracher, A, Klenk, H.D, Weissenhorn, W. | Deposit date: | 2002-08-05 | Release date: | 2003-04-10 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | The Matrix Protein Vp40 from Ebola Virus Octamerizes Into Pore-Like Structures with Specific RNA Binding Properties Structure, 11, 2003
|
|
1H2D
| Ebola virus matrix protein VP40 N-terminal domain in complex with RNA (Low-resolution VP40[31-212] variant). | Descriptor: | 5'-R(*UP*GP*AP)-3', CHLORIDE ION, MATRIX PROTEIN VP40 | Authors: | Gomis-Ruth, F.X, Dessen, A, Bracher, A, Klenk, H.D, Weissenhorn, W. | Deposit date: | 2002-08-06 | Release date: | 2003-04-10 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The Matrix Protein Vp40 from Ebola Virus Octamerizes Into Pore-Like Structures with Specific RNA Binding Properties Structure, 11, 2003
|
|
6TAV
| Crystal structure of endopeptidase-induced alpha2-macroglobulin | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Alpha-2-macroglobulin, ... | Authors: | Gomis-Ruth, F.X, Duquerroy, S, Trapani, S, Marrero, A, Goulas, T, Guevara, T, Andersen, G.A, Sottrup-Jensen, L, Navaza, J. | Deposit date: | 2019-10-30 | Release date: | 2021-05-12 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (4.2 Å) | Cite: | Cryo-EM structures shows the mechanistic basis of pan-peptidase inhibition by human alpha2-macroglobulin Proc.Natl.Acad.Sci.USA, 2022
|
|
6SAZ
| Cleaved human fetuin-b in complex with crayfish astacin | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Astacin, ... | Authors: | Gomis-Ruth, F.X, Guevara, T, Cuppari, A, Korschgen, H, Schmitz, C, Kuske, M, Yiallouros, I, Floehr, J, Jahnen-Dechent, W, Stocker, W. | Deposit date: | 2019-07-18 | Release date: | 2019-10-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The C-terminal region of human plasma fetuin-B is dispensable for the raised-elephant-trunk mechanism of inhibition of astacin metallopeptidases. Sci Rep, 9, 2019
|
|
6I9A
| Porphyromonas gingivalis gingipain K (Kgp) in complex with inhibitor KYT-36 | Descriptor: | (2S,3S)-1,4-DIMERCAPTOBUTANE-2,3-DIOL, 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, CALCIUM ION, ... | Authors: | Gomis-Ruth, F.X, Guevara, T, Rofdriguez-Banqueri, A. | Deposit date: | 2018-11-22 | Release date: | 2019-03-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.2 Å) | Cite: | Structural determinants of inhibition of Porphyromonas gingivalis gingipain K by KYT-36, a potent, selective, and bioavailable peptidase inhibitor. Sci Rep, 9, 2019
|
|
8QB1
| C-terminal domain of mirolase from Tannerella forsythia | Descriptor: | CHLORIDE ION, DI(HYDROXYETHYL)ETHER, Mirolase, ... | Authors: | Gomis-Ruth, F.X, Rodriguez-Banqueri, A, Mizgalska, D, Veillard, F, Goulas, T, Eckhard, U, Potempa, J. | Deposit date: | 2023-08-23 | Release date: | 2024-02-28 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (1.601 Å) | Cite: | Structural and functional insights into the C-terminal signal domain of the Bacteroidetes type-IX secretion system. Open Biology, 14, 2024
|
|
6ZA2
| Crystal structure of dimeric latent PorU from Porphyromonas gingivalis | Descriptor: | CALCIUM ION, Por secretion system protein porU | Authors: | Gomis-Ruth, F.X, Goulas, T, Guevara, T, Rodriguez-Banqueri, A, Potempa, J. | Deposit date: | 2020-06-04 | Release date: | 2021-09-29 | Last modified: | 2024-06-19 | Method: | X-RAY DIFFRACTION (3.35 Å) | Cite: | Intermolecular latency regulates the essential C-terminal signal peptidase and sortase of the Porphyromonas gingivalis type-IX secretion system. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
6I0X
| Porphyromonas gingivalis peptidylarginine deminase (PPAD) mutant G231N/E232T/N235D in complex with Cl-amidine. | Descriptor: | GLYCEROL, N-[(1S)-1-(AMINOCARBONYL)-4-(ETHANIMIDOYLAMINO)BUTYL]BENZAMIDE, Peptidylarginine deiminase, ... | Authors: | Gomis-Ruth, F.X, Goulas, T, Sola, M, Potempa, J. | Deposit date: | 2018-10-26 | Release date: | 2019-01-23 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure, function, and inhibition of a genomic/clinical variant of Porphyromonas gingivalis peptidylarginine deiminase. Protein Sci., 28, 2019
|
|
6HT9
| Mouse fetuin-B in complex with crayfish astacin | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Astacin, ... | Authors: | Gomis-Ruth, F.X, Goulas, T, Guevara, T, Cuppari, A. | Deposit date: | 2018-10-03 | Release date: | 2019-03-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structure of mammalian plasma fetuin-B and its mechanism of selective metallopeptidase inhibition. Iucrj, 6, 2019
|
|
6I9J
| Human transforming growth factor beta2 in a tetragonal crystal form | Descriptor: | Transforming growth factor beta-2 proprotein | Authors: | Gomis-Ruth, F.X, Marino-Puertas, L, del Amo-Maestro, L, Goulas, T. | Deposit date: | 2018-11-23 | Release date: | 2019-07-03 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Recombinant production, purification, crystallization, and structure analysis of human transforming growth factor beta 2 in a new conformation. Sci Rep, 9, 2019
|
|
8EHC
| |
8EHB
| |
8EHD
| Structure of Tannerella forsythia potempin E | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, Potempin E (PotE) | Authors: | Gomis-Ruth, F.X. | Deposit date: | 2022-09-14 | Release date: | 2022-12-21 | Last modified: | 2024-10-09 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | A unique network of attack, defence and competence on the outer membrane of the periodontitis pathogen Tannerella forsythia. Chem Sci, 14, 2023
|
|
8EHE
| |
7AUW
| Inhibitory complex of human meprin beta with mouse fetuin-B. | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-[alpha-L-fucopyranose-(1-6)]2-acetamido-2-deoxy-beta-D-glucopyranose, Fetuin-B, ... | Authors: | Eckhard, U, Gomis-Ruth, F.X. | Deposit date: | 2020-11-03 | Release date: | 2021-04-14 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | The crystal structure of a 250-kDa heterotetrameric particle explains inhibition of sheddase meprin beta by endogenous fetuin-B. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
3OSL
| Structure of bovine thrombin-activatable fibrinolysis inhibitor in complex with tick carboxypeptidase inhibitor | Descriptor: | Carboxypeptidase B2, Carboxypeptidase inhibitor, ZINC ION | Authors: | Valnickova, Z, Sanglas, L, Arolas, J.L, Petersen, S.V, Schar, C, Otzen, D, Aviles, F.X, Gomis-Ruth, F.X, Enghild, J.J. | Deposit date: | 2010-09-09 | Release date: | 2010-09-29 | Last modified: | 2017-11-08 | Method: | X-RAY DIFFRACTION (6 Å) | Cite: | Flexibility of the Thrombin-activatable Fibrinolysis Inhibitor Pro-domain Enables Productive Binding of Protein Substrates. J.Biol.Chem., 285, 2010
|
|
1SAX
| Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
2PCU
| Human carboxypeptidase A4 in complex with a cleaved hexapeptide. | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, ASPARTIC ACID, Carboxypeptidase A4, ... | Authors: | Bayes, A, Fernandez, D, Sola, M, Marrero, A, Garcia-Pique, S, Aviles, F.X, Vendrell, J, Gomis-Ruth, F.X. | Deposit date: | 2007-03-30 | Release date: | 2007-04-17 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Caught after the Act: a human A-type metallocarboxypeptidase in a product complex with a cleaved hexapeptide. Biochemistry, 46, 2007
|
|
2BOA
| Human procarboxypeptidase A4. | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CARBOXYPEPTIDASE A4, ... | Authors: | Garcia-Castellanos, R, Bonet-Figueredo, R, Pallares, I, Ventura, S, Aviles, F.X, Vendrell, J, Gomis-Ruth, F.X. | Deposit date: | 2005-04-08 | Release date: | 2005-12-13 | Last modified: | 2024-10-16 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Detailed Molecular Comparison between the Inhibition Mode of A/B-Type Carboxypeptidases in the Zymogen State and by the Endogenous Inhibitor Latexin. Cell.Mol.Life Sci., 62, 2005
|
|