5LFJ
 
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-01 | | Release date: | 2016-11-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LFQ
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P3) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.503 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LFP
 | | Crystal Structure of the Bacterial Proteasome Activator Bpa of Mycobacterium tuberculosis (space group P6322, SeMet) | | Descriptor: | Bacterial proteasome activator | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-07-04 | | Release date: | 2016-11-23 | | Last modified: | 2016-12-14 | | Method: | X-RAY DIFFRACTION (3.303 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
5LZP
 | | Binding of the C-terminal GQYL motif of the bacterial proteasome activator Bpa to the 20S proteasome | | Descriptor: | Bacterial proteasome activator, Proteasome subunit alpha, Proteasome subunit beta | | Authors: | Bolten, M, Delley, C.L, Leibundgut, M, Boehringer, D, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-09-30 | | Release date: | 2016-11-23 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Structural Analysis of the Bacterial Proteasome Activator Bpa in Complex with the 20S Proteasome.
Structure, 24, 2016
|
|
6SJ9
 | | Proteasome accessory factor B/C (PafBC) of Arthrobacter aurescens | | Descriptor: | DI(HYDROXYETHYL)ETHER, POTASSIUM ION, Proteasome accessory factor B/C (PafBC), ... | | Authors: | Mueller, A.U, Leibundgut, M, Ban, N, Weber-Ban, E. | | Deposit date: | 2019-08-13 | | Release date: | 2019-10-16 | | Last modified: | 2019-10-23 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure and functional implications of WYL domain-containing bacterial DNA damage response regulator PafBC.
Nat Commun, 10, 2019
|
|
5LRT
 | | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP and Phosphate | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DI(HYDROXYETHYL)ETHER, Depupylase, ... | | Authors: | Bolten, M, Vahlensieck, C, Lipp, C, Leibundgut, M, Ban, N, Weber-Ban, E. | | Deposit date: | 2016-08-19 | | Release date: | 2017-02-01 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Depupylase Dop Requires Inorganic Phosphate in the Active Site for Catalysis.
J. Biol. Chem., 292, 2017
|
|
1K8A
 | | Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | | Deposit date: | 2001-10-23 | | Release date: | 2002-07-19 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit.
Mol.Cell, 10, 2002
|
|
4B0T
 | | Structure of the Pup Ligase PafA of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ADP | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, PUP--PROTEIN LIGASE | | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.159 Å) | | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
|
|
4B0R
 | | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway | | Descriptor: | DEAMIDASE-DEPUPYLASE DOP | | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structures of Pup ligase PafA and depupylase Dop from the prokaryotic ubiquitin-like modification pathway.
Nat Commun, 3, 2012
|
|
4B0S
 | | Structure of the Deamidase-Depupylase Dop of the Prokaryotic Ubiquitin-like Modification Pathway in Complex with ATP | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, DEAMIDASE-DEPUPYLASE DOP, MAGNESIUM ION | | Authors: | Ozcelik, D, Barandun, J, Schmitz, N, Sutter, M, Guth, E, Damberger, F.F, Allain, F.H.-T, Ban, N, Weber-Ban, E. | | Deposit date: | 2012-07-04 | | Release date: | 2012-09-12 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.85 Å) | | Cite: | Structures of Pup Ligase Pafa and Depupylase Dop from the Prokaryotic Ubiquitin-Like Modification Pathway.
Nat.Commun., 3, 2012
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
5EF5
 | | Crystal structure of Chaetomium thermophilum Raptor | | Descriptor: | Raptor from Chaetomium thermophilum | | Authors: | Imseng, S, Sauer, E, Aylett, C.H.S, Boehringer, D, Hall, M.N, Ban, N, Maier, T. | | Deposit date: | 2015-10-23 | | Release date: | 2015-12-30 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (4.3 Å) | | Cite: | Architecture of human mTOR complex 1.
Science, 351, 2016
|
|
7P5X
 | | Mycobacterial RNAP with transcriptional activator PafBC | | Descriptor: | DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, DNA-directed RNA polymerase subunit beta', ... | | Authors: | Mueller, A.U, Kummer, E, Schilling, C.M, Ban, N, Weber-Ban, E. | | Deposit date: | 2021-07-15 | | Release date: | 2021-12-22 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | Transcriptional control of mycobacterial DNA damage response by sigma adaptation.
Sci Adv, 7, 2021
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
4V59
 | | Crystal structure of fatty acid synthase complexed with nadp+ from thermomyces lanuginosus at 3.1 angstrom resolution. | | Descriptor: | FATTY ACID SYNTHASE ALPHA SUBUNITS, FATTY ACID SYNTHASE BETA SUBUNITS, FLAVIN MONONUCLEOTIDE, ... | | Authors: | Jenni, S, Leibundgut, M, Boehringer, D, Frick, C, Mikolasek, B, Ban, N. | | Deposit date: | 2007-03-09 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling
Science, 316, 2007
|
|
4V5B
 | | Structure of PDF binding helix in complex with the ribosome. | | Descriptor: | 16S RIBOSOMAL RNA, 23S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, ... | | Authors: | Bingel-Erlenmeyer, R, Kohler, R, Kramer, G, Sandikci, A, Antolic, S, Maier, T, Schaffitzel, C, Wiedmann, B, Bukau, B, Ban, N. | | Deposit date: | 2007-11-22 | | Release date: | 2014-07-09 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.74 Å) | | Cite: | A Peptide Deformylase-Ribosome Complex Reveals Mechanism of Nascent Chain Processing.
Nature, 452, 2008
|
|
4V8T
 | | Cryo-EM Structure of the 60S Ribosomal Subunit in Complex with Arx1 and Rei1 | | Descriptor: | 25S RIBOSOMAL RNA, 5.8S RIBOSOMAL RNA, 5S RIBOSOMAL RNA, ... | | Authors: | Greber, B.J, Boehringer, D, Montellese, C, Ban, N. | | Deposit date: | 2012-08-07 | | Release date: | 2014-07-09 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (8.1 Å) | | Cite: | Cryo-Em Structures of Arx1 and Maturation Factors Rei1 and Jjj1 Bound to the 60S Ribosomal Subunit
Nat.Struct.Mol.Biol., 19, 2012
|
|
4V8L
 | |
6YDP
 | |
6YDW
 | |
3DKT
 | | Crystal structure of Thermotoga maritima encapsulin | | Descriptor: | Maritimacin, Putative uncharacterized protein | | Authors: | Sutter, M, Boehringer, D, Gutmann, S, Weber-Ban, E, Ban, N. | | Deposit date: | 2008-06-26 | | Release date: | 2008-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (3.104 Å) | | Cite: | Structural basis of enzyme encapsulation into a bacterial nanocompartment
Nat.Struct.Mol.Biol., 15, 2008
|
|
8BTK
 | | Structure of the TRAP complex with the Sec translocon and a translating ribosome | | Descriptor: | 18S rRNA, 28S rRNA, 40S ribosomal protein S11, ... | | Authors: | Jaskolowski, M, Jomaa, A, Gamerdinger, M, Shrestha, S, Leibundgut, M, Deuerling, E, Ban, N. | | Deposit date: | 2022-11-29 | | Release date: | 2023-05-24 | | Last modified: | 2024-04-24 | | Method: | ELECTRON MICROSCOPY (3.5 Å) | | Cite: | Molecular basis of the TRAP complex function in ER protein biogenesis.
Nat.Struct.Mol.Biol., 30, 2023
|
|
1KC8
 | | Co-crystal Structure of Blasticidin S Bound to the 50S Ribosomal Subunit | | Descriptor: | 23S RRNA, 5S RRNA, BLASTICIDIN S, ... | | Authors: | Hansen, J.L, Ban, N, Nissen, P, Moore, P.B, Steitz, T.A. | | Deposit date: | 2001-11-07 | | Release date: | 2003-07-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (3.01 Å) | | Cite: | Structures of Five Antibiotics Bound at the Peptidyl Transferase Center of
the Large Ribosomal Subunit
J.Mol.Biol., 330, 2003
|
|
8C9G
 | | Priestia megaterium mupirocin-sensitive isoleucyl-tRNA synthetase 1 complexed with mupirocin | | Descriptor: | CHLORIDE ION, GLYCEROL, Isoleucine--tRNA ligase, ... | | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Ban, N, Gruic-Sovulj, I. | | Deposit date: | 2023-01-22 | | Release date: | 2023-08-23 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif.
Nat Commun, 14, 2023
|
|
8C8U
 | | Priestia megaterium mupirocin-resistant isoleucyl-tRNA synthetase 2 complexed with mupirocin | | Descriptor: | Isoleucine--tRNA ligase, L(+)-TARTARIC ACID, MUPIROCIN, ... | | Authors: | Brkic, A, Leibundgut, M, Jablonska, J, Zanki, V, Car, Z, Petrovic Perokovic, V, Gruic-Sovulj, I, Ban, N. | | Deposit date: | 2023-01-21 | | Release date: | 2023-08-23 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (1.901 Å) | | Cite: | Antibiotic hyper-resistance in a class I aminoacyl-tRNA synthetase with altered active site signature motif.
Nat Commun, 14, 2023
|
|
